LGALS1 Human

What is human LGALS1 and what is its basic structure?

Human LGALS1 (Lectin, Galactoside-Binding, Soluble, 1) is a member of the galectin family of beta-galactoside-binding proteins. It consists of 135 amino acids (positions A2-D135 in the mature protein) and functions as a homodimer in physiological conditions . The protein contains conserved carbohydrate recognition domains (CRDs) that mediate binding to beta-galactoside sugars. Structurally, LGALS1 adopts a beta-sandwich fold typical of the galectin family, with multiple beta-strands arranged in two sheets forming a carbohydrate-binding groove.

What are the primary biological functions of LGALS1?

LGALS1 serves multiple biological functions within human cells and tissues:

• Regulates apoptosis in various cell types

• Modulates cell proliferation, often acting as an autocrine negative growth factor

• Influences cell differentiation processes

• Inhibits CD45 protein phosphatase activity, preventing dephosphorylation of Lyn kinase

• Functions as a strong inducer of T-cell apoptosis, contributing to immune regulation

• Participates in cell-cell and cell-matrix interactions

These diverse functions highlight LGALS1's role as a multifunctional protein involved in fundamental cellular processes.

What is the tissue distribution pattern of human LGALS1?

LGALS1 exhibits a wide tissue distribution pattern with variable expression levels:

Within placental tissues, LGALS1 is specifically expressed in trophoblasts, stromal cells, villous endothelium, syncytiotrophoblast apical membrane, and villous stroma . This distinct expression pattern suggests tissue-specific functions related to pregnancy and immunomodulation.

What disease associations have been identified for LGALS1?

Research has established several disease associations for LGALS1:

• Hypopyon Ulcer and Ring Corneal Ulcer have been directly linked to LGALS1 dysregulation

• Acute Myeloid Leukemia (AML) progression shows significant correlation with LGALS1 expression levels

• Immune tolerance modulation during pregnancy involves LGALS1, suggesting implications in pregnancy-related disorders

• Cancer progression and immune evasion in various malignancies have been connected to aberrant LGALS1 expression

What are the optimal methods for detecting and quantifying LGALS1 expression?

Several methodologies can be employed for reliable LGALS1 detection and quantification:

ELISA-Based Detection:

• Sandwich ELISA represents the gold standard for quantitative detection of human Galectin-1 in biological samples

• Commercial kits offer detection ranges from 0.31 ng/mL to 200 ng/mL depending on sample type

• Sample compatibility includes plasma, serum, tissue homogenates, cell lysates, and cell culture supernatants

• Cross-reactivity testing confirms high specificity with no detectable cross-reactions with other relevant proteins

Molecular Detection Methods:

• RT-qPCR using validated primers (Forward: GGAGCGAGATCCCTCCAAAAT; Reverse: GGCTGTTGTCATACTTCTCATGG) with GAPDH as reference gene

• Western blotting with antibodies such as LGALS1 (1:1000, # A5590, Selleck) using GAPDH (1:1000, #ab8245, Abcam) as loading control

• Flow cytometry for cellular analyses, particularly useful for examining LGALS1 expression in specific cell populations

How can researchers effectively modulate LGALS1 expression in experimental models?

Several approaches have been validated for experimental manipulation of LGALS1 expression:

RNA Interference:

• shRNA-mediated knockdown using validated sequences:

  • shLGALS1#1: 5ʹ-CCGGGCTGCCAGATGGATACGAATTCTCGAGAATTCGTATCCATCTGGCAGCTTTTTG-3ʹ

  • shLGALS1#2: 5ʹ-CCGGCGCTAAGAGCTTCGTGCTGAACTCGAGTTCAGCACGAAGCTCTTAGCGTTTTTG-3ʹ

  • shLGALS1#3: 5ʹ-CCGGGTGTGTAACACCAAGGAAGATCTCGAGATCTTCCTTGGTGTTACACACTTTTTG-3ʹ

Lentiviral Delivery Systems:

• pLKO.1-puro vector has demonstrated efficient delivery of shRNA constructs

• Transduction efficiency should be verified via appropriate selection methods and expression analysis

Functional Validation:

• Cell proliferation assessment via EdU incorporation assay

• Apoptosis evaluation using Annexin V-APC staining

• Cell cycle analysis with Ki67-PE and DAPI staining

What is the role of LGALS1 in cancer progression and therapy resistance?

LGALS1 has emerged as a key player in cancer biology through multiple mechanisms:

AML Pathophysiology:

• LGALS1 is highly expressed in leukemic stem cells (LSCs) compared to healthy hematopoietic stem cells (HSCs)

• High expression correlates with poor prognosis in AML patients

• LGALS1 repression inhibits AML cell and LSC proliferation while enhancing apoptosis

Lipid Metabolism Reprogramming:

• LGALS1 functions within a novel LGALS1-dependent fatty acid metabolism-related signature (LFMRS)

• LGALS1 repression decreases lipid accumulation both in vitro and in vivo

• Targeting LGALS1 curbs AML progression through metabolic modulation

Immunomodulatory Effects:

• LGALS1 suppression increases CD8+ T cell and NK cell counts in vivo

• This protein creates immunosuppressive tumor microenvironments that facilitate cancer immune evasion

• Targeting LGALS1 may enhance immunotherapy efficacy through reversal of immunosuppression

What are the considerations for isolating primary cells expressing LGALS1?

The isolation of primary cells expressing LGALS1 requires specific methodological approaches:

Hematopoietic Stem Cells (HSCs):

• Isolate mononuclear cells via Ficoll density gradient centrifugation

• Deplete lineage-positive cells using commercial kits (e.g., EasySep™ Human Progenitor Cell Enrichment Kit II)

• Isolate Lin-CD34+CD38- cells via flow cytometry using anti-CD34-APC and anti-CD38-PE antibodies

Leukemic Stem Cells (LSCs):

• Process patient samples through density gradient centrifugation

• Isolate CD34+CD38- cells via flow cytometry using anti-CD34-APC and anti-CD38-PE antibodies

• Verify LGALS1 expression via RT-qPCR and Western blot

Tissue-Specific Isolation:

• For placental tissues, separate trophoblasts, stromal cells, and endothelial cells using enzymatic digestion followed by immunomagnetic separation

• For other tissues, adapt protocols based on tissue-specific requirements while maintaining cell viability

How does LGALS1 modulate immune responses and what are the implications?

LGALS1 exhibits significant immunomodulatory properties with therapeutic implications:

T-Cell Regulation:

• Acts as a potent inducer of T-cell apoptosis

• Inhibits CD45 protein phosphatase activity, affecting T-cell receptor signaling

• Contributes to immune tolerance mechanisms

Pregnancy-Related Immune Modulation:

• Expressed in placenta, maternal decidua, and fetal membranes

• Contributes to immune tolerance mechanisms essential for successful pregnancy

• May represent a therapeutic target for pregnancy complications with immune origins

Cancer Immunotherapy Implications:

• LGALS1 repression increases CD8+ T and NK cell counts in vivo

• May serve as a target to enhance immunotherapeutic approaches in cancer

• Combining LGALS1 inhibition with immune checkpoint blockade could represent a synergistic approach

What methodological approaches are optimal for studying LGALS1 in fatty acid metabolism pathways?

Recent research has established LGALS1's role in fatty acid metabolism, particularly in cancer contexts:

LFMRS Model Development:

• Utilize bioinformatics analysis, univariate and multivariate COX regression analysis to establish LGALS1-dependent and immune-associated fatty acid metabolism-related signature (LFMRS)

• Validate model using multiple databases (TCGA, BeatAML, GEO)

Lipid Accumulation Assessment:

• Measure lipid accumulation following LGALS1 modulation

• Employ quantitative lipid staining techniques in vitro and in vivo

• Correlate findings with clinical outcomes in patient samples

Pathway Analysis:

• Perform single-sample Gene Set Enrichment Analysis (ssGSEA) to identify enriched pathways

• Use the "GSVA" R package for comprehensive pathway analysis

• Identify differentially expressed genes using the "limma" R package with appropriate statistical thresholds (p < 0.05, |logFC| > 1)

What experimental considerations are important when designing LGALS1 functional studies?

When designing experiments to investigate LGALS1 function, researchers should consider:

Expression System Selection:

• E. coli-based expression systems have been validated for producing functional LGALS1 protein standards

• The immunogen sequence (A2-D135) represents the optimal construct for functional studies

Functional Readouts:

• Cell proliferation: EdU incorporation assay and Ki67 staining

• Apoptosis: Annexin V-APC and DAPI staining

• Cell cycle analysis: Combined Ki67-PE and DAPI staining

Validation Approaches:

• Employ multiple shRNA constructs to confirm specificity of LGALS1 knockdown effects

• Include appropriate controls (shNC) in all experimental designs

• Validate findings across multiple cell lines and primary patient samples

What are the emerging therapeutic approaches targeting LGALS1?

Current research suggests several promising therapeutic directions:

Cancer Therapy:

• Development of specific LGALS1 inhibitors to target cancer cells and leukemic stem cells

• Combining LGALS1 inhibition with conventional chemotherapies

• Exploration of LGALS1 as a biomarker for patient stratification and personalized treatment approaches

Immunomodulatory Applications:

• Targeting LGALS1 to enhance anti-tumor immune responses

• Developing LGALS1-based approaches for autoimmune disease management

• Investigating LGALS1 modulation for pregnancy-related immune disorders

Metabolic Reprogramming:

• Targeting LGALS1-dependent lipid metabolism in cancer

• Exploring the interplay between LGALS1, metabolism, and immune function

• Developing combination therapies targeting both metabolic and immune aspects of LGALS1 function