gas2 Antibody

What is GAS2 and what are its key properties?

GAS2 (Growth Arrest-Specific 2) is a 313 amino acid protein with a calculated molecular weight of 35 kDa, which corresponds to its observed molecular weight in experimental systems . It is encoded by the GAS2 gene (Gene ID: 2620) and is highly conserved between species, with the same apparent molecular mass (36 kD) observed in both mouse and human samples .

GAS2 expression is tightly associated with growth arrest, and its biosynthesis reflects the pattern of mRNA expression described in earlier studies . The protein is particularly abundant in liver, lung, and kidney tissues, while notably absent in the spleen, suggesting tissue-specific functions .

At the subcellular level, GAS2 is a component of the microfilament system, colocalizing with actin fibers at the cell border and along stress fibers in growth-arrested NIH 3T3 cells . This localization pattern can be reproduced in growing cells when purified GST-Gas2 protein is microinjected .

What applications are GAS2 antibodies suitable for?

GAS2 antibodies have been validated for multiple research applications, with specific performance characteristics varying by antibody clone and manufacturer. Based on the available data, GAS2 antibodies are recommended for:

When selecting a GAS2 antibody, researchers should consider the specific validated applications for their particular antibody clone, as not all antibodies perform equally across all applications .

What tissues and cell types have shown positive GAS2 detection?

Successful detection of GAS2 has been reported in various sample types:

Interestingly, oncogene-transformed NIH 3T3 cell lines did not show GAS2 expression induction under serum starvation conditions, suggesting a potential loss of growth arrest-specific regulation in transformed cells .

What are the recommended storage and handling conditions for GAS2 antibodies?

For optimal performance and longevity of GAS2 antibodies, the following storage and handling recommendations should be followed:

• Store at -20°C, where antibodies remain stable for one year after shipment

• Aliquoting is generally unnecessary for -20°C storage

• Smaller size formats (20μl) may contain 0.1% BSA as a stabilizer

• Most GAS2 antibodies are supplied in PBS with 0.02% sodium azide and 50% glycerol at pH 7.3

• Avoid repeated freeze-thaw cycles to maintain antibody integrity

• Follow manufacturer-specific recommendations, as formulations may vary slightly between vendors

How does GAS2 function in apoptosis regulation and what are its molecular mechanisms?

GAS2 plays a significant role in apoptotic processes through several mechanisms:

GAS2 serves as a substrate for caspases during programmed cell death, specifically being cleaved by caspase-3 and caspase-7 at Asparagine 278 . This cleavage event triggers substantial alterations in the actin cytoskeleton, resulting in dramatic changes in cell morphology that are characteristic of apoptosis .

The relationship between GAS2 and apoptosis is further evidenced by recent research showing that a novel variant of GAS2 promotes its own protein degradation, microtubule disorganization, and cellular apoptosis, leading to hearing loss in carriers . This suggests that GAS2 integrity is crucial for normal cellular function and survival.

Additional interactions with apoptotic regulatory proteins have been observed. Research has demonstrated relationships between altered calpain activity in chronic myeloid leukemia, which impairs apoptosis by increasing survivin in myeloid progenitors and XIAP1 in differentiating granulocytes, with potential involvement of GAS2 in these pathways .

The molecular connection between GAS2's cytoskeletal functions and its role in apoptosis represents an important area for further investigation, with significant implications for understanding cellular death mechanisms in both normal physiology and disease states.

What post-translational modifications regulate GAS2 function?

GAS2 undergoes significant post-translational regulation, primarily through phosphorylation:

During the G0-G1 transition phase of the cell cycle, GAS2 is phosphorylated on serine residues, which influences its localization and function within the cell . This phosphorylation appears to be a critical regulatory mechanism that modulates GAS2 activity in response to cell cycle progression.

Beyond standard phosphorylation, GAS2 can undergo hyperphosphorylation, which causes the protein to accumulate specifically at membrane ruffles . This suggests that different phosphorylation states direct GAS2 to distinct subcellular locations, potentially enabling diverse functions within different cellular compartments.

The available evidence indicates that GAS2 is regulated not only at the transcriptional level but also at the post-translational level via these phosphorylation mechanisms . This dual regulation allows for fine-tuned control of GAS2 activity in response to various cellular signals and conditions.

These modifications represent important regulatory checkpoints that allow cells to modulate GAS2 function in response to changing conditions, particularly during transitions between proliferation and growth arrest states.

What is the relationship between GAS2 and cytoskeletal organization?

GAS2 exhibits a multifaceted relationship with the cytoskeleton:

Immunofluorescence studies have definitively established that GAS2 is a component of the microfilament system, showing precise colocalization with actin fibers at the cell border and along stress fibers in growth-arrested NIH 3T3 cells . This pattern of distribution can be experimentally reproduced by microinjecting purified GST-Gas2 protein into growing cells .

Beyond actin interactions, GAS2 also influences microtubule organization. Recent research has linked a novel GAS2 variant to microtubule disorganization, indicating that GAS2 may play a broader role in cytoskeletal architecture than previously appreciated . This finding expands our understanding of GAS2's cytoskeletal functions beyond the actin network.

GAS2 actively participates in membrane ruffling, a process essential for cell movement and morphological changes . This involvement in dynamic membrane structures further underscores GAS2's role in regulating cellular shape and mobility through cytoskeletal modulation.

When GAS2 is cleaved by caspases during apoptosis, significant alterations in the actin cytoskeleton occur, resulting in dramatic changes in cell morphology . This observation directly links GAS2's cytoskeletal functions to programmed cell death pathways.

These multiple cytoskeletal interactions position GAS2 as a potential integrator of different cytoskeletal systems and cellular processes, particularly at the intersection of growth arrest, apoptosis, and cell morphology.

How do recent discoveries of GAS2 mutations impact our understanding of disease mechanisms?

Recent research has uncovered important connections between GAS2 variants and disease:

A novel variant in GAS2 has been directly associated with autosomal dominant hearing loss, representing a significant advance in understanding the molecular basis of this condition . This variant promotes its own protein degradation, causes microtubule disorganization, and triggers cellular apoptosis in carriers .

The molecular mechanisms underlying this pathology involve alterations in GAS2's normal cellular functions. The researchers identified that the truncated mutant GAS2 (GAS2mu) contains exons 1–6 (205 amino acids) and intron 6 (36 amino acids), resulting in a protein with aberrant structure and function .

To investigate this variant, researchers cloned DNA sequences encoding both wild-type GAS2 (GAS2wt) and the truncated GAS2mu into expression vectors with an N-terminal HA tag . This experimental approach allowed for detailed comparative analysis of the normal and mutant proteins.

The discovery of this GAS2 variant and its association with hearing loss opens new avenues for understanding how cytoskeletal proteins contribute to sensory function and how their disruption leads to pathology. This research highlights the potential involvement of GAS2 in other diseases where cytoskeletal organization and apoptotic regulation play crucial roles.

What experimental approaches are recommended for characterizing novel GAS2 variants?

When investigating novel GAS2 variants, researchers should consider a comprehensive approach:

Molecular Cloning and Expression Analysis:

• Clone both wild-type and variant GAS2 sequences into appropriate expression vectors (e.g., pCI/neo with N-terminal tags for detection)

• Use optimized PCR conditions: PrimeSTARTM HS DNA Polymerase with specific thermal cycling parameters (33 cycles at 98°C for 3 min, 98°C for 10 s, and 68°C for 40 s, followed by extension at 68°C for 10 min)

• Design primers targeting specific regions, such as:

  • Exon 2-3: 5'GGTGCCTTGCTCTGTCAACT3' and 5'GAGGACCAAACCTTCCGATT3'

  • Exon 6-Intron 6: 5'AGTACAGGAAACTTACTGGATG3' and 5'TTAGACTGATACGAGATTGCA3'

Protein Expression and Localization:

• Analyze protein expression using Western blotting with appropriate antibodies

• Examine subcellular localization through immunofluorescence, focusing on colocalization with cytoskeletal elements

• Compare distribution patterns between wild-type and variant proteins, particularly at cell borders, stress fibers, and membrane ruffles

Functional Characterization:

• Assess effects on microtubule organization and stability

• Evaluate impact on apoptotic processes, including monitoring caspase activation and cleavage events

• Investigate effects on cell morphology and cytoskeletal dynamics

• Examine potential alterations in post-translational modifications, particularly phosphorylation states

Protein-Protein Interaction Studies:

• Use immunoprecipitation to identify binding partners

• Compare interaction profiles between wild-type and variant proteins

• Focus on interactions with cytoskeletal components and apoptotic regulators

What are the optimal protocols for using GAS2 antibodies in Western blotting?

For optimal Western blotting results with GAS2 antibodies, researchers should follow these methodological recommendations:

Sample Preparation:

• GAS2 has been successfully detected in multiple sample types, including human kidney tissue, human liver tissue, Jurkat cells, and mouse liver tissue

• Standard protein extraction protocols using appropriate lysis buffers are generally sufficient

• Protein quantification and equal loading are critical for comparative analyses

Antibody Selection and Dilution:

• Choose antibodies validated specifically for Western blotting

• Use recommended dilution ranges: typically 1:500-1:2400 for most GAS2 antibodies

• Consider that optimal dilutions may be sample-dependent and should be determined empirically for each experimental system

Detection Parameters:

• The expected molecular weight for GAS2 is approximately 35 kDa

• Note that post-translational modifications may alter migration patterns

• When using tagged recombinant proteins, account for the additional mass of the tag

Protocol Optimization:

• Follow manufacturer-specific protocols when available

• For the 11941-2-AP antibody (Proteintech), a specific Western blot protocol is available for download

• It is recommended that researchers titrate the antibody in their testing system to obtain optimal results

How should samples be prepared for immunohistochemistry with GAS2 antibodies?

Successful immunohistochemical detection of GAS2 requires careful attention to sample preparation and processing:

Tissue Processing:

• GAS2 antibodies have been validated for immunohistochemistry on various tissues, with particularly successful detection reported in human lung cancer tissue

• Standard formalin fixation and paraffin embedding procedures are generally suitable

Antigen Retrieval:

• Antigen retrieval is crucial for optimal staining

• Primary recommendation: TE buffer at pH 9.0

• Alternative method: citrate buffer at pH 6.0

• Selection between these methods may depend on specific tissue characteristics and should be empirically determined

Antibody Application:

• Recommended dilution range for IHC: 1:50-1:500

• Optimal dilution may vary based on tissue type, fixation method, and detection system

• Incubation conditions should follow standard protocols for IHC (typically overnight at 4°C for primary antibodies)

Detection Systems:

• Standard secondary antibody detection systems are compatible

• Both chromogenic (e.g., DAB) and fluorescent detection methods can be employed

• When using fluorescent detection, consider potential background autofluorescence in tissues like liver and kidney

What controls should be included when using GAS2 antibodies in experimental designs?

Proper experimental controls are essential for generating reliable and interpretable results with GAS2 antibodies:

Positive Controls:

• Include tissues or cells known to express GAS2:

  • Human kidney tissue

  • Human liver tissue

  • Jurkat cells

  • Mouse liver tissue

• Growth-arrested NIH 3T3 cells are particularly useful as they show strong GAS2 expression

Negative Controls:

• Primary antibody omission controls to assess non-specific binding of secondary antibodies

• Isotype controls (e.g., Rabbit IgG for polyclonal rabbit antibodies)

• Consider using spleen tissue, which has been reported to lack GAS2 expression

• Oncogene-transformed NIH 3T3 cell lines under serum starvation may serve as negative controls, as they do not show GAS2 expression induction

Specificity Validation:

• Peptide competition assays to confirm antibody specificity

• RNA interference (siRNA/shRNA) to confirm signal reduction following GAS2 knockdown

• For recombinant expression studies, empty vector controls

Technical Controls:

• Loading controls for Western blotting (e.g., GAPDH, β-actin)

• When studying GAS2 variants, include both wild-type and mutant constructs for comparison

• For phosphorylation studies, include phosphatase-treated samples as controls

What experimental approaches are recommended for studying GAS2's role in cytoskeletal organization?

To investigate GAS2's involvement in cytoskeletal dynamics, several specialized approaches are recommended:

Immunofluorescence Co-localization Studies:

• Perform dual-labeling with GAS2 antibodies and cytoskeletal markers:

  • Actin filaments (phalloidin staining or anti-actin antibodies)

  • Microtubules (anti-α-tubulin antibodies)

• Analyze colocalization at specific subcellular regions (cell borders, stress fibers, membrane ruffles)

• Compare patterns between growth-arrested and proliferating cells

Live-Cell Imaging:

• Express fluorescently tagged GAS2 constructs for real-time visualization

• Monitor dynamic changes in GAS2 localization during:

  • Cell cycle progression

  • Growth factor stimulation

  • Induction of apoptosis

• Track co-movement with labeled cytoskeletal components

Functional Perturbation:

• Overexpress wild-type or mutant GAS2 and assess effects on:

  • Actin organization

  • Microtubule stability

  • Cell morphology

  • Membrane dynamics

• Perform microinjection of purified GST-Gas2 protein into growing cells to recapitulate the distribution pattern observed in growth-arrested cells

Biochemical Interaction Studies:

• Conduct co-immunoprecipitation to identify direct binding partners

• Perform in vitro binding assays with purified cytoskeletal proteins

• Investigate post-translational modifications that regulate cytoskeletal interactions

How can phosphorylation states of GAS2 be effectively analyzed?

Given the importance of phosphorylation in regulating GAS2 function, specialized approaches for detecting and characterizing these modifications are essential:

Phosphorylation-Specific Detection:

• Utilize phospho-specific antibodies if available

• Apply Phos-tag SDS-PAGE for mobility shift detection of phosphorylated species

• Employ 2D gel electrophoresis to separate differentially phosphorylated forms

Biochemical Characterization:

• Perform in vitro kinase assays to identify kinases responsible for GAS2 phosphorylation

• Use phosphatase treatments to confirm phosphorylation status

• Apply mass spectrometry-based approaches for precise identification of phosphorylation sites

Cell Cycle Analysis:

• Synchronize cells at different cell cycle stages (particularly G0-G1 transition)

• Monitor GAS2 phosphorylation status throughout the cell cycle

• Correlate phosphorylation with subcellular localization changes, particularly accumulation at membrane ruffles during hyperphosphorylation

Mutagenesis Studies:

• Generate phospho-mimetic (Ser to Asp/Glu) and phospho-null (Ser to Ala) mutants

• Assess the impact of these mutations on:

  • Subcellular localization

  • Cytoskeletal interactions

  • Growth arrest responses

  • Apoptotic susceptibility