GLUL Human

What is the basic function of GLUL in human metabolism?

GLUL (Glutamate-Ammonia Ligase), also known as Glutamine Synthetase (GS), catalyzes the ATP-dependent conversion of glutamate and ammonia to glutamine. This enzyme plays critical roles in multiple physiological processes including ammonia detoxification, acid-base homeostasis, cell signaling, and cell proliferation. In the brain, GLUL regulates levels of toxic ammonia and converts neurotoxic glutamate to glutamine, while in the liver, it contributes to ammonia removal from circulation . The enzymatic reaction is particularly important as glutamine serves as a major source of energy and participates in crucial cellular processes such as proliferation and inhibition of apoptosis .

What is the molecular structure of active human GLUL?

Human GLUL is a single, non-glycosylated polypeptide chain containing 373 amino acids with a molecular mass of approximately 42 kDa in its native form . The recombinant form often used in research may contain additional elements such as a His-Tag for purification purposes, resulting in slight variations in molecular weight (e.g., 44.2 kDa for His-tagged versions) . The enzyme requires manganese ions for binding and catalytic activity, as reflected in its Gene Ontology annotations that include manganese ion binding . The protein's three-dimensional structure facilitates its ATP-dependent enzymatic function and provides binding sites for substrates and regulatory molecules that modulate its activity in different physiological contexts .

How do I optimize storage conditions for recombinant GLUL to maintain activity?

For optimal storage of recombinant GLUL, follow these evidence-based recommendations: Store at 4°C if the entire vial will be used within 2-4 weeks. For longer storage periods, keep the protein frozen at -20°C . To enhance stability during long-term storage, add a carrier protein such as 0.1% HSA (Human Serum Albumin) or BSA (Bovine Serum Albumin). This prevents protein adsorption to surfaces and protects against degradation . Most importantly, avoid multiple freeze-thaw cycles, as they can significantly compromise protein structure and enzymatic activity . Some formulations include stabilizing agents like DTT (5mM) and glycerol (10-20%) to maintain the protein in its native conformation .

How can isotope labeling approaches be used to measure GLUL activity in cancer cells?

"Targeted stable isotope resolved metabolomics" provides a direct measurement of GLUL activity in cancer cells by tracing the fate of glutamine-derived nitrogen within the cell's biochemical network. The methodology involves applying 13C-labeled glutamate and 15N-labeled ammonium as substrates for GLUL, then determining the enrichment of both isotopes in glutamine and downstream metabolites such as nucleotides . This dual-isotope tracing approach can specifically address the GLUL reaction within the metabolic network, revealing how cells overcome glutamine depletion through compensatory pathways dependent on GLUL activity . The technique has demonstrated that cellular glutamine synthesis serves as an important resistance factor against nutrient deprivation and potentially contributes to drug resistance in cancer cells . Researchers should analyze isotope enrichment patterns using mass spectrometry to determine metabolic flux through the GLUL pathway under various experimental conditions.

What are the mechanisms behind GLUL's enzyme-independent functions in cancer progression?

GLUL promotes cancer cell growth through both enzyme-dependent and enzyme-independent mechanisms, particularly in lung cancer. Research has demonstrated that GLUL knockdown significantly reduces cell growth even under glutamine-sufficient conditions, whereas blocking its enzyme function with MSO (methionine sulfoximine) does not have the same inhibitory effect in most cancer cell lines . The enzyme-independent function appears to involve the regulation of CaMK2G transcription, which affects cell cycle progression with notable decreases in G0/G1 phase ratios in GLUL-knocked-down cells . This dual functionality suggests that GLUL provides survival and growth advantages to cancer cells in both glutamine-restricted regions (through enzyme-dependent functions) and glutamine-sufficient areas (through enzyme-independent functions) . For investigating these mechanisms, researchers should employ both enzyme inhibition (using MSO) and protein knockdown approaches to distinguish between enzymatic and non-enzymatic roles.

How do start-loss variants in GLUL affect neurodevelopment?

Recent research has identified clustered de novo start-loss variants in GLUL resulting in developmental and epileptic encephalopathy through a distinct molecular mechanism. These variants lead to translation initiation from methionine 18, downstream of the N-terminal degron motif . This produces a protein that remains enzymatically competent but becomes insensitive to negative feedback regulation by glutamine, resulting in a stabilized glutamine synthetase . Analysis of human single-cell transcriptomes shows that GLUL is widely expressed in neuro- and glial-progenitor cells and mature astrocytes but not in post-mitotic neurons . Despite one patient exhibiting periventricular nodular heterotopia (a neuronal migration disorder), overexpression of stabilized GS in mice using in utero electroporation did not demonstrate migratory deficits . This suggests the importance of tight regulation of glutamine metabolism during neurodevelopment rather than direct effects on neuronal migration. Researchers studying these variants should employ mass spectrometry to confirm altered protein structure and stability, along with functional assays to assess enzymatic regulation.

What are the optimal conditions for measuring GLUL enzymatic activity in vitro?

The specific activity of human GLUL is optimally measured at pH 7.5 and 37°C in a coupled system with pyruvate kinase/lactate dehydrogenase (PK/LDH) . The standardized activity is defined as the amount of enzyme that converts 1.0 pmole of L-glutamate to L-glutamine per minute under these conditions, with recombinant human GLUL typically showing activity >2,800 pmol/min/μg . The reaction buffer should contain 20mM Tris-HCl (pH 7.5-8.0), with sufficient ATP as a co-substrate, and manganese ions as cofactors . Researchers should include 5mM DTT to maintain reducing conditions that preserve cysteine residues critical for catalytic activity . For accurate measurements, establish a standard curve with known quantities of glutamine and monitor the reaction spectrophotometrically by tracking ADP production through the coupled enzyme system. Validate measurements by including appropriate negative controls with heat-inactivated enzyme and positive controls with commercially available standards.

What qPCR parameters should be used for reliable GLUL expression analysis?

For optimal qPCR analysis of GLUL expression, use validated primer pairs targeting conserved regions of the GLUL transcript. The forward primer sequence CTGCCATACCAACTTCAGCACC and reverse primer sequence ATAGGCACGGATGTGGTACTGG have been validated for human GLUL (NM_002065) . Follow this PCR program for reliable results: Activation at 50°C for 2 min; pre-soak at 95°C for 10 min; followed by 40 cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min . Include a melting curve analysis (95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec) to confirm specific amplification . Use reference genes such as GAPDH, ACTB, or other contextually appropriate housekeeping genes for normalization. For human tissue samples, consider tissue-specific expression patterns, as GLUL is differentially expressed across tissues, with particularly high expression in muscle, liver, and brain . Validate primers with positive controls and include no-template controls to ensure specificity and sensitivity of the assay.

What Western blotting protocols provide the most reliable detection of GLUL protein?

For optimal Western blotting detection of GLUL protein, use a validated primary antibody such as GLUL (D2O3F) Rabbit mAb at 1:1000 dilution, which has been tested for reactivity with human, mouse, and rat GLUL . The expected molecular weight for detection is approximately 42 kDa . Sample preparation should include protease inhibitors to prevent degradation, and 20-40 μg of total protein per lane typically provides sufficient signal. For cell lysate preparation, use RIPA buffer containing protease inhibitors, and denature samples at 95°C for 5 minutes in Laemmli buffer with beta-mercaptoethanol. Run samples on a 10-12% SDS-PAGE gel for optimal separation in the 30-50 kDa range. After transfer to PVDF membrane, block with 5% non-fat dry milk in TBST for 1 hour at room temperature. Incubate with primary antibody overnight at 4°C followed by HRP-conjugated secondary antibody at 1:5000 dilution . For enhanced sensitivity, consider using chemiluminescent detection systems with short exposure times to prevent signal saturation, which is important for quantitative analysis of the 42 kDa GLUL protein.

How does GLUL expression correlate with clinical outcomes in different cancer types?

GLUL expression shows significant correlation with clinical outcomes across various cancer types, though the relationship varies by cancer type. In non-small-cell lung carcinoma (NSCC), a positive correlation exists between GLUL expression levels and clinical stage, indicating worse prognosis with higher expression . High GLUL expression in breast cancer patients is associated with larger tumor size and elevated HER2 expression . In glioma and liver cancers, GLUL serves as a predictor of poor survival, with higher expression correlating with worse clinical outcomes . Interestingly, GLUL expression in cancer tissues is often heterogeneous, with GLUL-positive cancer cells frequently surrounded by GLUL-negative cells, suggesting functional specialization within the tumor microenvironment . For researchers investigating GLUL as a prognostic marker, tissue microarray analysis with immunohistochemistry provides valuable spatial information about heterogeneous expression patterns, while quantitative approaches like qPCR and Western blotting offer more precise quantification for correlation with clinical parameters.

What experimental approaches best demonstrate GLUL's role in cancer cell growth under varying glutamine conditions?

To effectively demonstrate GLUL's role in cancer cell growth under different glutamine conditions, researchers should implement a multi-faceted experimental approach. First, establish GLUL knockdown cell lines using siRNA or shRNA, alongside scrambled controls, in multiple cancer cell lines to account for heterogeneity . Compare cell proliferation in both glutamine-sufficient (full medium) and glutamine-depleted conditions using cell counting assays, colony formation assays, and cell cycle analysis by flow cytometry . To distinguish between enzyme-dependent and enzyme-independent functions, combine genetic knockdown with pharmacological inhibition using methionine sulfoximine (MSO) to specifically block enzymatic activity while maintaining protein expression . For metabolic analysis, implement stable isotope tracing with 13C-glutamate and 15N-ammonium to track glutamine synthesis and utilization pathways . Additionally, establish single-cell clones from parental cell lines to identify and characterize GLUL-high and GLUL-low subpopulations within heterogeneous cancer cell populations . These approaches collectively provide comprehensive insights into how GLUL contributes to cancer cell growth through both enzymatic and non-enzymatic mechanisms under varying nutrient conditions.

How can researchers investigate the relationship between oncogenic pathways and GLUL expression?

To investigate the relationship between oncogenic pathways and GLUL expression, researchers should employ a comprehensive approach combining transcriptional regulation analysis with signaling pathway modulation. First, analyze the GLUL promoter region for binding sites of oncogenic transcription factors such as β-catenin, c-Myc, and others implicated in cancer . Conduct chromatin immunoprecipitation (ChIP) assays to confirm direct binding of these factors to the GLUL promoter in cancer cells. Implement reporter assays using GLUL promoter constructs to quantify transcriptional activation by specific oncogenic factors . Modulate key oncogenic pathways (β-catenin, AKT, Myc, GNC2) using both pharmacological inhibitors and genetic approaches (overexpression/knockdown), then measure changes in GLUL expression at mRNA and protein levels . For in vivo validation, analyze GLUL expression in patient-derived xenografts or genetically engineered mouse models with activated oncogenic pathways. Additionally, investigate post-translational regulation by examining the glutamine-induced degradation pathway, which may be dysregulated in cancer cells, allowing high GLUL expression despite sufficient glutamine levels . This multi-level analysis will reveal how oncogenic pathways overcome normal regulatory mechanisms to maintain elevated GLUL expression in cancer cells.

How is GLUL activity regulated at the post-translational level?

GLUL activity is tightly regulated at the post-translational level through multiple mechanisms, with the N-terminal degron playing a pivotal role. This degron enables ubiquitin-mediated degradation of GLUL in a glutamine-induced manner, providing feedback inhibition when glutamine levels are sufficient . Recent research on start-loss variants highlights the importance of this regulation—when translation begins at methionine 18 (downstream of the degron), the resulting protein remains enzymatically active but becomes insensitive to glutamine-mediated degradation . Additionally, GLUL undergoes autopalmitoylation and may function as a palmitoyltransferase for other proteins like RHOJ, suggesting a complex regulatory network beyond its primary enzymatic function . GLUL activity is also modulated by intracellular manganese levels, as this ion is essential for its catalytic function . For a comprehensive understanding of GLUL regulation, researchers should investigate ubiquitination patterns, half-life measurements with cycloheximide chase assays, and activity assessments under varying glutamine conditions. These approaches will reveal how post-translational modifications influence both enzyme stability and catalytic activity in different physiological and pathological states.

What are the consequences of GLUL mutations in neurological disorders?

GLUL mutations have profound consequences for neurological development and function, as evidenced by recent research on start-loss variants resulting in developmental and epileptic encephalopathy. These mutations lead to severe developmental delay, seizures, and white matter abnormalities . The molecular mechanism involves stabilization of glutamine synthetase through loss of the N-terminal degron, creating a protein that functions enzymatically but becomes insensitive to negative feedback regulation by glutamine . Interestingly, despite these severe neurological manifestations, patients show normal plasma and cerebrospinal fluid biochemistry, suggesting localized metabolic disruptions that don't manifest in systemic glutamine levels . One patient with a start-loss variant exhibited periventricular nodular heterotopia, indicating potential impacts on neuronal migration, though direct experimental evidence in mouse models did not confirm migratory deficits . These findings highlight how dysregulation of glutamine metabolism during critical neurodevelopmental periods can have severe consequences, even when the enzyme itself remains catalytically active. For researchers studying these disorders, advanced neuroimaging combined with metabolomic profiling of specific brain regions would provide valuable insights into the spatiotemporal aspects of metabolic disruptions caused by GLUL mutations.

How does GLUL function independently of its enzymatic activity in cellular processes?

GLUL exhibits significant non-enzymatic functions that contribute to cellular processes independent of its glutamine synthetase activity. One key enzyme-independent role is in endothelial cell migration during vascular development, where GLUL regulates the membrane localization and activation of the GTPase RHOJ . This function appears to involve GLUL's ability to promote RHOJ palmitoylation, potentially acting as a palmitoyltransferase by first autopalmitoylating itself and then transferring the palmitoyl group to RHOJ . In cancer cells, GLUL promotes growth under glutamine-sufficient conditions through mechanisms distinct from its enzymatic function, as demonstrated by the differential effects of enzyme inhibition versus protein knockdown . GLUL knockdown reduces cell growth and alters cell cycle progression, while enzymatic inhibition with MSO has minimal effects under glutamine-sufficient conditions . GLUL also plays a role in ribosomal 40S subunit biogenesis, further expanding its non-enzymatic functions . To investigate these non-canonical functions, researchers should employ domain-specific mutants that retain protein structure but lack enzymatic activity, combined with interaction studies to identify binding partners involved in these diverse cellular processes.