GPR173 Antibody

What is GPR173 and what are its primary functions?

GPR173, also known as SREB3, is a member of the G-protein coupled receptor 1 family containing 7 transmembrane domains and conserved cysteine residues . This receptor has gained significant research interest due to its potential roles in neurogenesis, neuroprotection, and peptidergic signaling pathways, particularly in the context of brain ischemia and reperfusion (I/R) injury . Recent studies have demonstrated that GPR173 expression increases significantly in response to cerebral ischemia-reperfusion, suggesting it may play a neuroprotective role during brain injury . The receptor has also been identified as potentially mediating phoenixin (PNX) signaling, which is involved in neuroplasticity mechanisms in the brain . Understanding GPR173 function is critical for researchers investigating novel neuroprotective strategies and neurogenesis pathways.

What are the key technical specifications of commonly available GPR173 antibodies?

GPR173 antibodies are typically available as polyclonal antibodies derived from rabbit hosts with reactivity against human and mouse GPR173 proteins . The antibodies target specific epitopes such as the intracellular third loop region (amino acid residues 274-286 of mouse GPR173) . While the calculated molecular weight of GPR173 is approximately 41 kDa, the observed molecular weight in Western blot applications is often around 53 kDa, suggesting post-translational modifications . These antibodies are generally validated for Western blot applications with recommended dilutions ranging from 1:500 to 1:2000 . The discrepancy between calculated and observed molecular weights is an important consideration when interpreting experimental results, as it represents the presence of post-translational modifications rather than non-specific binding.

How should GPR173 antibody specificity be validated?

Proper validation of GPR173 antibody specificity is essential for ensuring reliable experimental results. A recommended validation protocol includes:

• Western blot analysis using various tissue lysates (e.g., rat brain, mouse brain) and cell lines (e.g., SHSY-5Y neuroblastoma, BV-2 microglia) known to express GPR173

• Inclusion of blocking peptide controls to verify binding specificity

• Comparative analysis across multiple species if cross-reactivity is claimed

• Immunohistochemical staining of regions with established GPR173 expression, such as hippocampal CA3 regions

Experimental validation should include negative controls and demonstrate the antibody detects bands of appropriate molecular weight (approximately 53 kDa for GPR173). The use of blocking peptides is particularly valuable, as demonstrated in validation studies showing elimination of GPR173-specific bands when antibodies are pre-incubated with blocking peptides .

What is the optimal storage condition for GPR173 antibodies?

GPR173 antibodies should be stored at -20°C for optimal stability and performance . The antibodies are typically supplied in phosphate buffered solution (pH 7.4) containing stabilizers (approximately 0.05%) and glycerol (50%) . When shipped, the antibodies are typically transported with ice packs and should be stored immediately upon receipt at the recommended temperature . Avoid repeated freeze-thaw cycles as these can significantly degrade antibody performance and specificity. Most commercially available GPR173 antibodies maintain validity for approximately 12 months when stored under these conditions .

How does GPR173 expression change during cerebral ischemia-reperfusion?

Research has demonstrated significant alterations in GPR173 expression following cerebral ischemia-reperfusion (I/R) injury. In experimental models using adult male Wistar rats subjected to I/R, GPR173-positive cells were exclusively found in the ischemic hemisphere, co-localized with neurogenesis markers including Musashi-1, doublecortin (DCX), and Sox-2 . Gene expression analysis revealed a significant increase in GPR173 mRNA levels in the I/R-affected striatum compared to control tissue .

The time course of GPR173 expression suggests extremely rapid upregulation, which may be specifically related to neuroprotective neurochemical changes occurring in this region after I/R injury . This temporal and spatial pattern of expression indicates GPR173 may serve as an early marker of neurogenic response to ischemic injury and potentially participate in endogenous neuroprotective mechanisms. For researchers studying stroke models or neuroprotection, temporal analysis of GPR173 expression may provide valuable insights into the critical window for therapeutic intervention.

What are the optimal protocols for detecting GPR173 in brain tissue samples?

For effective detection of GPR173 in brain tissue samples, researchers should consider the following optimized protocols:

For Western Blot Analysis:

• Prepare fresh tissue lysates from brain regions of interest (striatum shows particularly robust GPR173 expression after I/R)

• Use a 1:500 dilution of primary GPR173 antibody for optimal signal-to-noise ratio

• Include appropriate positive controls (e.g., SHSY-5Y neuroblastoma lysates)

• Recognize that the expected band will appear at approximately 53 kDa rather than the calculated 41 kDa

• Include blocking peptide controls to verify specificity of observed bands

For Immunohistochemical Detection:

• Use perfusion-fixed frozen brain sections for optimal antigen preservation

• Apply GPR173 antibody at 1:200 dilution followed by fluorophore-conjugated secondary antibodies

• Focus particular attention on regions showing differential expression, such as the hippocampal CA3 region and striatum

• Co-stain with neurogenesis markers (Musashi-1, DCX, Sox-2) to identify potential associations

These methodological approaches have been empirically validated in multiple studies examining GPR173 expression in rodent brain tissues.

What molecular mechanisms explain the discrepancy between calculated and observed molecular weights of GPR173?

The observed discrepancy between the calculated molecular weight of GPR173 (41 kDa) and its apparent molecular weight in Western blots (53 kDa) can be attributed to several post-translational modifications commonly occurring in G-protein coupled receptors . These modifications include:

• Glycosylation at conserved N-linked glycosylation sites

• Phosphorylation of serine and threonine residues in the intracellular domains

• Palmitoylation of conserved cysteine residues

• Formation of disulfide bonds between conserved extracellular cysteine residues

The presence of these modifications significantly alters protein mobility during gel electrophoresis, resulting in the higher observed molecular weight. This phenomenon is common among membrane proteins and should not be interpreted as non-specific binding . Researchers can confirm the identity of the observed band through specific inhibition with blocking peptides or through advanced techniques such as mass spectrometry analysis of immunoprecipitated proteins.

How does GPR173 signaling interact with neurogenesis pathways after brain injury?

GPR173 signaling appears to be intricately linked with neurogenesis pathways following brain injury, particularly in the context of ischemia-reperfusion. Studies have demonstrated co-localization of GPR173-positive cells with established neurogenesis markers including Musashi-1, doublecortin (DCX), and Sox-2 in the striatum following I/R injury . This spatial and temporal association suggests GPR173 may participate in the orchestration of adult neurogenesis responses to ischemic injury.

The mechanism likely involves:

• Rapid upregulation of GPR173 expression in response to ischemic stress

• Interaction with phoenixin (PNX) neuropeptide signaling pathways

• Activation of downstream signaling cascades that promote neuronal survival and differentiation

• Modulation of peptidergic signaling in the affected brain regions

These findings confirm previous research suggesting that I/R stimulates adult neurogenesis in the striatum and affects peptidergic signaling in this structure . The very rapid occurrence of GPR173 expression in the striatum appears to be exclusively related to neuroprotective neurochemical changes that occur after I/R, making it a potential therapeutic target for stroke and other ischemic brain injuries .

What methodological approaches are recommended for GPR173 knockdown studies?

For effective GPR173 knockdown studies, researchers have successfully employed shRNA-mediated approaches. Based on published methodologies, the following protocol has proven effective for GPR173 knockdown:

• Design and clone shRNA sequences targeting GPR173 mRNA, with the sequence ACGTGGGCACCTACAAGTTTA shown to be highly effective

• Incorporate appropriate selection markers (e.g., hygromycin B resistance) for stable selection

• Generate lentiviral particles for efficient cell transduction

• Screen transduced cells with appropriate antibiotics (e.g., 400 μg/mL Hygromycin B) for at least one week

• Verify knockdown efficiency using quantitative RT-PCR with primers specifically targeting GPR173 transcripts: forward primer 5'-TCTGGTCACCCTACATCGTG-3' and reverse primer 5'-CAGTAGGGTTCTCTGGGAGC-3'

• Use actb as an endogenous control gene for normalization purposes

• Calculate knockdown efficiency using the 2−ΔCt method with at least three biological replicates

This methodological approach provides a reliable system for investigating GPR173 function through loss-of-function studies in appropriate cellular models.

How can functional GPR173 signaling be measured in experimental settings?

Functional characterization of GPR173 signaling can be effectively achieved through calcium mobilization assays, as G-protein coupled receptors frequently signal through calcium-dependent pathways . The recommended protocol includes:

• Seed approximately 8 × 10^4 transfected cells expressing GPR173 for calcium imaging experiments

• Load cells with appropriate calcium indicators

• Stimulate with potential ligands (phoenixin has been implicated as a potential GPR173 ligand)

• Monitor calcium flux using confocal microscopy or fluorescence plate readers

• Analyze response kinetics and amplitude to quantify receptor activation

This approach allows researchers to characterize the functional properties of GPR173 and screen for potential agonists or antagonists that could modulate its activity in neurological disease contexts.

What are the key experimental considerations when investigating GPR173 in neurological disease models?

When investigating GPR173 in neurological disease models, particularly in cerebral ischemia models, several key experimental considerations should be addressed:

• Time-course analysis: GPR173 expression changes rapidly after ischemia-reperfusion, necessitating careful temporal analysis across multiple timepoints

• Regional specificity: Examine multiple brain regions, as GPR173 shows regionally specific expression patterns, with particular importance in the striatum and hippocampus

• Co-expression analysis: Always perform co-staining with neurogenesis markers (Musashi-1, DCX, Sox-2) to establish relationships between GPR173 and neurogenic responses

• Functional outcomes: Correlate molecular changes in GPR173 expression with behavioral and functional outcomes to establish physiological relevance

• Mechanistic interventions: Employ pharmacological or genetic approaches to modulate GPR173 function and assess impacts on disease progression

These methodological considerations will help ensure robust and reproducible results when studying GPR173 in neurological disease contexts.

What is the potential relationship between GPR173 and CCK receptor signaling?

Recent research has identified a novel relationship between GPR173 and cholecystokinin (CCK) receptor signaling, suggesting GPR173 may function as a CCK receptor that mediates potentiation of specific signaling pathways . This unexpected functional relationship expands our understanding of GPR173 beyond its previously established roles. Researchers investigating GPR173 should consider:

• Examining potential cross-talk between phoenixin and CCK signaling pathways

• Investigating whether GPR173 may serve as an alternative receptor for CCK peptides in specific brain regions

• Exploring how this dual signaling capability might contribute to GPR173's neuroprotective effects

This emerging direction represents a significant shift in our understanding of GPR173 function and warrants further investigation through both in vitro and in vivo experimental approaches.

How should researchers approach translational studies of GPR173 in human neurological disorders?

Translational studies of GPR173 in human neurological disorders should consider several methodological approaches:

• Human tissue analysis: Examine GPR173 expression in post-mortem brain samples from patients with relevant neurological disorders compared to healthy controls

• Cell line validation: Utilize human neuronal cell lines like SHSY-5Y and microglial cell lines like HMC3, which have been shown to express GPR173

• Patient-derived models: Consider induced pluripotent stem cell (iPSC)-derived neurons from patients with neurological disorders to study GPR173 in a disease-relevant context

• Biomarker potential: Explore whether GPR173 or its ligands could serve as biomarkers for specific neurological conditions

• Genetic association studies: Investigate whether GPR173 genetic variants are associated with neurological disease risk or outcomes

This multi-faceted approach will facilitate translation of basic GPR173 research findings toward potential clinical applications in neurological disorders, particularly those involving ischemic injury or neurodegeneration.