GPR180 Antibody

Shipped with Ice Packs
In Stock

Description

Definition and Applications

A GPR180 antibody is a polyclonal or monoclonal immunoglobulin that binds specifically to the GPR180 protein. Its primary applications include:

  • Western blot: To quantify GPR180 protein levels in tissues or cells.

  • Immunohistochemistry (IHC): To visualize GPR180 localization in adipose tissue, liver, or vascular tissues.

  • Functional assays: To block or modulate GPR180 activity in cell culture or in vivo models.

Research Findings and Antibody Utility

The following studies highlight the utility of GPR180 antibodies in elucidating its biological roles:

Thermogenic Adipocyte Function

  • In a 2021 study, GPR180 antibodies were used to confirm knockdown efficiency in beige adipocytes, where GPR180 silencing reduced UCP1 expression and mitochondrial respiration .

  • Adipocyte-specific knockout mice (Gpr180KO) showed impaired glucose tolerance, with GPR180 antibodies validating protein ablation in adipose tissue .

Lipid Metabolism

  • In a 2023 study, GPR180 antibodies demonstrated that Gpr180KO mice exhibited reduced hepatic lipid accumulation and plasma lipid levels, suggesting GPR180’s role in promoting mTORC1 signaling and lipogenesis .

TGFβ Signaling

  • GPR180’s interaction with TGFβ signaling was confirmed using co-immunoprecipitation assays and antibodies targeting SMAD3 phosphorylation .

Data Table: GPR180 Antibody Applications in Research

ApplicationMethodologyKey FindingsCitation
Thermogenic functionWestern blot, CRISPR/Cas9 knockoutReduced UCP1 expression and mitochondrial respiration in beige adipocytes .
Lipid metabolismIHC, AAV-mediated rescueAmeliorated hepatic lipid accumulation with Gpr180KO mice .
TGFβ signalingCo-IP, SMAD3 phosphorylationGPR180 regulates TGFβ receptor activity via SMAD3 phosphorylation .

Limitations and Future Directions

  • Specificity: Cross-reactivity with homologous proteins (e.g., GPCR family members) must be validated in antibody development.

  • Commercial Availability: GPR180 antibodies are not widely commercialized, necessitating custom production for most studies.

  • Therapeutic Potential: Antibodies targeting GPR180 could serve as tools for modulating metabolism or treating metabolic disorders, but in vivo efficacy remains unexplored .

Product Specs

Buffer
Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide.
Form
Liquid
Lead Time
Typically, we can ship your orders within 1-3 business days of receipt. Delivery times may vary based on the shipping method and destination. Please consult your local distributor for specific delivery timelines.
Synonyms
GPR180; ITR; Integral membrane protein GPR180; Intimal thickness-related receptor
Target Names
GPR180
Uniprot No.

Target Background

Gene References Into Functions
  1. A null GPR180 mutation has been observed to segregate over two generations in individuals with iridocorneal angle dysgenesis. This finding supports the hypothesis that deletions within this gene are responsible for microphthalmia with ocular retardation (MCOR). PMID: 25772937
  2. A comprehensive screening of genomic DNA from 48 healthy Japanese individuals led to the identification of 22 SNPs located within the ITR locus. PMID: 12730718
Database Links

HGNC: 28899

OMIM: 607787

KEGG: hsa:160897

STRING: 9606.ENSP00000366157

UniGene: Hs.439363

Subcellular Location
Membrane; Multi-pass membrane protein.

Q&A

What is GPR180 and why is it important in metabolic research?

GPR180 was initially classified as a G protein-coupled receptor, but recent research has revealed it's actually a component of the TGFβ signaling pathway that regulates the activity of the TGFβ receptor complex through SMAD3 phosphorylation . It plays crucial roles in:

  • Brown and beige adipocyte thermogenic function

  • Whole-body glucose homeostasis

  • Lipid metabolism in adipose tissue

GPR180 expression in humans is associated with improved metabolic control, making it a promising therapeutic target for metabolic disorders . Recent findings indicate GPR180 functions to suppress lipid accumulation in adipocytes and protects against high-fat diet-induced obesity .

What applications are GPR180 antibodies validated for?

Most commercial GPR180 antibodies have been validated for multiple applications:

ApplicationValidation StatusCommon Dilutions
ELISAWidely validated1:10000
Western Blotting (WB)Validated with human, mouse samples1:50-1:500
Immunohistochemistry (IHC)Validated with human, mouse tissues1:50-1:100
Immunofluorescence (IF)Validated for cellular localization studies1:100-1:500
Immunocytochemistry (ICC)Validated for cultured cellsSimilar to IF dilutions

When selecting an antibody, verify the validation data for your specific application and species of interest .

How should I validate a GPR180 antibody for my specific research?

Proper antibody validation is critical for generating reliable results. Follow these methodological steps:

  • Positive and negative controls: Use tissues known to express GPR180 (adipose tissue, vascular smooth muscle) as positive controls . For negative controls, consider using:

    • GPR180 knockout or knockdown samples

    • Pre-incubation of the antibody with immunizing peptide

    • Secondary antibody-only controls

  • Specificity testing: Verify that the antibody detects a band of the expected size (~49 kDa) in Western blotting.

  • Reproducibility assessment: Test antibody performance across multiple sample preparations and experimental conditions.

  • Cross-validation: Compare results with different antibodies targeting distinct epitopes of GPR180 if available .

  • Functional validation: For advanced studies, correlate antibody staining with known functional outcomes of GPR180 manipulation (e.g., effects on adipocyte function or TGFβ signaling) .

How can I optimize GPR180 antibody use for detecting changes in adipose tissue under different metabolic conditions?

Optimizing GPR180 detection in adipose tissue requires careful consideration of metabolic state and tissue preparation:

  • Sample collection and preservation:

    • For Western blotting: Snap-freeze samples in liquid nitrogen immediately after collection to preserve protein phosphorylation states that may influence GPR180 interactions with TGFβ signaling components .

    • For IHC/IF: Use 4% paraformaldehyde fixation for adequate tissue morphology preservation without excessive antigen masking .

  • Metabolic state considerations:

    • GPR180 expression significantly decreases in mice fed high-fat diet (HFD) in both subcutaneous and epididymal adipose tissues . Design experiments accounting for this baseline change.

    • Consider fasting/fed state as it affects metabolic signaling pathways that may interact with GPR180 function .

  • Tissue-specific optimization:

    • When analyzing brown vs. white adipose tissue, adjust protein extraction protocols to account for different lipid content .

    • For subcutaneous white adipose tissue, background can be higher; optimize blocking solutions (5% non-fat milk in TBST has been effective) .

  • Detection method selection:

    • For subtle expression changes, consider fluorescent secondary antibodies for quantitative Western blotting analysis .

    • For localization studies in adipocytes, confocal microscopy provides better resolution of membrane vs. cytoplasmic signal .

What controls are essential when studying GPR180 in TGFβ signaling contexts?

When investigating GPR180's role in TGFβ signaling, incorporate these specific controls:

  • Pathway activation controls:

    • Positive control: Include samples treated with known TGFβ pathway activators to verify pathway responsiveness.

    • Include phospho-SMAD3 detection to verify pathway activity status in relation to GPR180 expression or manipulation .

  • Topological controls:

    • When studying GPR180 membrane orientation, use both N-terminal and C-terminal tagged constructs as controls (C-terminal V5 tag is detectable in non-permeabilized conditions, while N-terminal HA tag requires permeabilization) .

  • Interaction verification:

    • Include co-immunoprecipitation negative controls (IgG pulldown) when studying GPR180 interactions with TGFβ signaling components.

    • Consider proximity ligation assays as an additional control for direct protein interactions .

  • Functional validation:

    • Include CTHRC1 treatment conditions, as GPR180 is required for CTHRC1 action in regulating adipocyte activity .

    • Monitor downstream effects on thermogenic genes (UCP1, PRDM16, PGC1α) as functional readouts of pathway activity .

How can I distinguish GPR180 function in lipogenesis regulation versus its other metabolic roles?

Separating GPR180's effects on lipogenesis from its other functions requires:

  • Gene expression analysis:

    • Use RT-qPCR to monitor specific lipogenesis genes affected by GPR180 manipulation:

    PathwayTarget GenesExpected Effect with GPR180 Overexpression
    LipogenesisSrebf1, Acaca, Fasn, Dgat1, Dgat2, Gpam, Scd1Decreased expression
    Fatty acid uptakeCd36, Fatp1, Fatp2, Fatp4Decreased expression
    Fatty acid oxidationAcadm, Acadvl, Cpt1α, PparαVariable or unchanged
    ThermogenesisUcp1, Prdm16, Pgc1αIncreased expression
  • Protein level verification:

    • Examine key proteins like ACC using Western blotting to confirm transcriptional changes translate to protein level alterations .

  • Functional assays:

    • Employ C-14-labeled lipid synthesis assays to directly measure de novo lipogenesis rates.

    • Use Fatty acid uptake assays with fluorescently labeled fatty acids to distinguish uptake from synthesis effects .

  • Signaling pathway dissection:

    • Investigate PKA pathway activity using phospho-PKA substrate antibodies, as GPR180 may regulate lipogenesis through a Gi-PKA-SREBP pathway in liver .

    • Examine nuclear localization of SREBPs as downstream effectors that regulate lipogenic gene expression .

What methodological approaches should be used when studying GPR180 topology and membrane orientation?

GPR180 was initially classified as a GPCR but recent evidence suggests a different membrane topology. To properly study its orientation:

  • Epitope tagging strategy:

    • Use differentially tagged constructs: N-terminal (e.g., HA-tag) and C-terminal (e.g., V5-tag) versions .

    • Perform immunofluorescence under both permeabilized and non-permeabilized conditions to determine which epitopes are accessible without membrane penetration .

  • Biochemical verification:

    • Perform protease protection assays in intact cells vs. permeabilized cells.

    • Use surface biotinylation followed by streptavidin pulldown to identify exposed domains.

  • Functional domain mapping:

    • Create domain deletion mutants to identify regions critical for interaction with TGFβ signaling components.

    • Examine GPR180's association with TGFβ receptor complex components through co-immunoprecipitation studies .

  • Overexpression verification:

    • When performing overexpression studies, verify proper membrane localization through subcellular fractionation.

    • Ensure that tagged constructs retain functional activity by examining downstream signaling events (e.g., SMAD3 phosphorylation) .

How can I design experiments to address contradictory findings regarding GPR180's role as a GPCR versus a TGFβ signaling component?

Addressing this fundamental contradiction requires carefully designed experiments:

  • G protein coupling assessment:

    • Perform comprehensive G protein activation assays using BRET or FRET-based sensors for multiple G protein subtypes.

    • Include positive controls (known GPCRs) and assay GPR180-dependent changes in second messengers (cAMP, Ca²⁺, etc.) .

  • TGFβ pathway interaction studies:

    • Conduct co-immunoprecipitation experiments between GPR180 and TGFβ receptor components.

    • Analyze SMAD3 phosphorylation in response to GPR180 overexpression or knockdown .

    • Compare GPR180 effects with known TGFβ pathway modulators.

  • Structure-function analysis:

    • Identify potential transmembrane domains and compare to canonical GPCR architecture.

    • Create chimeric proteins with domains from verified GPCRs to test functionality.

    • Utilize site-directed mutagenesis of potential G protein coupling domains .

  • Reconciliation approaches:

    • Investigate whether GPR180 might function through biased signaling (activating some pathways but not others).

    • Examine whether GPR180 possesses dual functionality depending on cellular context or activation state .

How does GPR180 antibody staining pattern differ between brown, beige, and white adipose tissues?

Understanding tissue-specific GPR180 expression patterns requires optimized staining protocols:

  • Tissue collection and preparation:

    • Collect adipose tissue from anatomically defined depots (subcutaneous, epididymal, interscapular).

    • Process tissues consistently to avoid artificial differences in staining intensity.

  • Expected staining patterns:

    • Brown adipose tissue (BAT): GPR180 expression is higher in BAT compared to white adipose tissue (WAT) .

    • Beige adipocytes: GPR180 knockdown reduces UCP1 expression, suggesting high expression in thermogenic beige cells .

    • White adipose tissue: Lower expression than BAT, with decreasing levels during high-fat diet feeding .

  • Co-staining recommendations:

    • Include UCP1 co-staining to identify thermogenic adipocytes.

    • Use perilipin to delineate adipocyte cell boundaries.

    • Consider co-staining with TGFβ pathway components to evaluate co-localization .

  • Technical considerations:

    • Brown/beige adipocytes have smaller lipid droplets and more cytoplasm than white adipocytes, requiring adjustment of exposure settings.

    • Use confocal microscopy for improved spatial resolution to distinguish membrane localization from cytoplasmic signal .

What are the key experimental design considerations for studying GPR180 in gene knockdown or knockout models?

When designing experiments using GPR180 genetic manipulation models:

  • Model selection and validation:

    • Global knockout: Assess whole-body effects on glucose tolerance and thermogenesis .

    • Adipocyte-specific knockout: More precisely examine cell-autonomous effects on adipocyte function .

    • shRNA knockdown: Useful for tissue-specific acute manipulation (e.g., AAV9-shRNA delivery) .

  • Functional validation:

    • Verify knockdown/knockout efficiency at both mRNA and protein levels using RT-qPCR and Western blotting .

    • Use multiple shRNA sequences to improve knockdown efficiency and control for off-target effects .

    • Example efficient shRNA sequences for GPR180:

      • 5′-CTCCCAAATTCAAGATGCTGTA-3′

      • 5′-TGCTTCAGCCTTAGCTAATTA-3′

      • 5′-GCTTCAGCCTTAGCTAATTAC-3′

      • 5′-GCTCTTGCTGATTGTCTTACG-3′

  • Phenotypic characterization:

    • Metabolic phenotyping: Glucose tolerance tests, insulin sensitivity, energy expenditure .

    • Molecular analyses: Changes in thermogenic gene expression (UCP1, PRDM16, PGC1α) .

    • Histological examination: Adipocyte size, multilocular appearance, lipid accumulation .

  • Control selection:

    • Use littermate controls with identical genetic background.

    • For conditional knockouts, include Cre-only controls to account for potential Cre toxicity .

How can I optimize Western blotting protocols specifically for GPR180 detection?

Achieving clean, specific Western blot detection of GPR180 requires:

  • Sample preparation optimization:

    • Use RIPA buffer with protease and phosphatase inhibitors for effective extraction .

    • For adipose tissue: Include additional lipid removal steps to prevent interference with protein separation.

  • Electrophoresis and transfer parameters:

    • Expected molecular weight: ~49 kDa .

    • Use 10-12% polyacrylamide gels for optimal resolution.

    • Transfer to nitrocellulose (NC) membrane has been reported effective .

  • Blocking and antibody incubation:

    • Blocking: 5% non-fat milk in TBST for 1 hour at room temperature .

    • Primary antibody incubation: Overnight at 4°C with gentle rocking.

    • Secondary antibody: 1 hour at room temperature .

  • Signal development and quantification:

    • Use β-actin as a loading control for total protein normalization .

    • Use ImageJ for densitometric analysis of band intensity .

  • Troubleshooting common issues:

    • High background: Increase washing duration/frequency and optimize antibody dilution.

    • Multiple bands: Verify specificity with knockout/knockdown samples as negative controls .

What are the most reliable primer sets for qPCR detection of GPR180 expression across different species?

For reliable qPCR detection of GPR180, consider these validated primer sets:

SpeciesForward Primer (5'-3')Reverse Primer (5'-3')Amplicon SizeReference
MouseTGTCAGAATCAACAACGTAGCAGTTGTCGGCATAGAACACTCGC~100-200 bp
Human(Design based on NM_180989)(Design based on NM_180989)~100-200 bp

For proper qPCR analysis:

  • Reference gene selection:

    • β-Actin (ACTb) has been validated as an effective reference gene for GPR180 expression studies .

    • Consider using multiple reference genes for more robust normalization.

  • Primer design considerations:

    • Design primers spanning exon-exon junctions to avoid genomic DNA amplification.

    • Verify primer specificity using BLAST and melt curve analysis.

  • Controls and validation:

    • Include no-template controls and no-reverse transcriptase controls.

    • Validate primer efficiency using standard curves.

    • Consider using positive control samples with known GPR180 expression (e.g., brown adipose tissue) .

How can immunoprecipitation protocols be optimized for studying GPR180 interactions with TGFβ signaling components?

For effective immunoprecipitation of GPR180 and associated proteins:

  • Lysis buffer optimization:

    • Use mild detergents (e.g., 1% NP-40 or 0.5% CHAPS) to preserve protein-protein interactions.

    • Include phosphatase inhibitors to maintain phosphorylation-dependent interactions with TGFβ signaling components .

  • Antibody selection:

    • Choose antibodies targeting internal regions of GPR180 that don't interfere with protein-protein interaction domains .

    • Verify antibody efficiency in immunoprecipitation before proceeding with interaction studies.

  • Controls:

    • Input control: 5-10% of lysate used for immunoprecipitation.

    • Negative control: Non-specific IgG matching the host species of the primary antibody.

    • Validation control: Perform reverse immunoprecipitation (pull down with antibodies against suspected interacting proteins).

  • Detection strategies:

    • Probe for TGFβ receptor components (TGFBR1, TGFBR2) and downstream mediators (SMAD2/3).

    • Consider testing for CTHRC1 interactions, as GPR180 is required for CTHRC1 action .

  • Advanced approaches:

    • For transient or weak interactions, consider using crosslinking agents before cell lysis.

    • For systematic identification of interactors, combine immunoprecipitation with mass spectrometry analysis.

How can GPR180 antibodies be used to investigate potential therapeutic applications targeting metabolic disorders?

Exploring GPR180 as a therapeutic target requires:

  • Target validation approaches:

    • Use antibodies to correlate GPR180 expression levels with metabolic outcomes in tissue samples from metabolic disease models .

    • Employ immunohistochemistry to examine GPR180 expression changes in response to existing metabolic therapeutics.

  • Mechanistic investigation:

    • Identify downstream pathways modulated by GPR180 using phospho-specific antibodies against key signaling molecules .

    • Examine changes in SMAD3 phosphorylation as a direct readout of GPR180's effect on TGFβ signaling .

  • Metabolic outcome correlation:

    • GWAS data have linked a minor allele of rs2298058, associated with increased GPR180 expression, to elevated serum triglyceride levels .

    • Utilize antibodies to examine how GPR180 protein expression correlates with rs2298058 genotype in human samples.

  • Translational considerations:

    • Compare GPR180 expression and function between rodent models and human samples using species-reactive antibodies .

    • Consider developing antibodies against specific phosphorylated forms of GPR180 if post-translational modifications are identified.

What novel methodological approaches can be combined with GPR180 antibodies to advance our understanding of its signaling mechanisms?

Integrating GPR180 antibodies with emerging technologies:

  • Proximity labeling approaches:

    • Combine BioID or APEX2 proximity labeling with GPR180 antibodies to identify proteins in close proximity to GPR180 in living cells.

    • Use antibodies to verify and quantify proximity labeling results.

  • Super-resolution microscopy:

    • Apply techniques like STORM or PALM with GPR180 antibodies to precisely localize GPR180 within cellular microdomains.

    • Combine with TGFβ receptor labeling to examine nanoscale organization of signaling complexes.

  • Single-cell analysis:

    • Integrate GPR180 antibody staining with single-cell RNA-seq data to correlate protein expression with transcriptional profiles.

    • Examine cell-to-cell variability in GPR180 expression within adipose tissue depots.

  • In vivo imaging applications:

    • Develop and validate fluorescently labeled GPR180 antibodies or antibody fragments for intravital microscopy.

    • Explore potential for antibody-based PET imaging probes to study GPR180 expression in metabolic tissues non-invasively.

  • Functional antibody applications:

    • Investigate whether function-blocking GPR180 antibodies can be developed to modulate its interaction with TGFβ signaling components .

    • Explore the potential for antibody-mediated targeted delivery of metabolic modulators to GPR180-expressing cells.

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.