GPR62 Antibody

What is GPR62 and why is it of interest in neuroscience research?

GPR62 is an orphan G protein-coupled receptor that belongs to the Class A (rhodopsin-like) family of GPCRs. It is primarily expressed in the central nervous system, specifically in mature oligodendrocytes, suggesting a potential role in myelination or axoglial interactions . It is also expressed in various regions of the brain including the cerebral cortex, cerebellum, hippocampus, thalamus and pituitary gland . The receptor is of particular interest because it is selectively expressed on the adaxonal myelin layer, making it a potential mediator of axon-oligodendrocyte communications . While knockout studies suggest GPR62 may have a minor or redundant role in CNS myelination, understanding its function could provide insights into neurological disorders involving myelin.

What signaling pathways does GPR62 activate?

GPR62 has been demonstrated to be constitutively active on multiple signaling pathways:

• Gs/cAMP pathway: Expression of GPR62 significantly activates cAMP signaling in a dose-dependent manner, even in the absence of a known ligand . This activation occurs in both the presence and absence of serum, excluding the possibility that a GPR62 ligand is present in the culture medium .

• Gq/IP1 pathway: GPR62 expression increases inositol phosphate (IP1) production in a dose-dependent manner up to 40% in HEK293T cells . The magnitude of this effect is comparable to that induced by a saturating concentration of angiotensin II in cells expressing the AT1 receptor .

• β-arrestin recruitment: GPR62 can dose-dependently recruit β-arrestin2 in a ligand-independent manner, indicating that it can also signal through G protein-independent pathways .

What are the available validation methods for GPR62 antibodies?

When validating GPR62 antibodies for research applications, several methods are recommended:

Note that GPR62 may form aggregates under standard denaturation conditions (95°C, 10 min), making it undetectable in Western blots. Modified denaturation conditions (55°C, 15 min or room temperature, 16 hours) can overcome this issue .

How can I definitively localize GPR62 expression in neural tissues given the limitations of existing antibodies?

Localizing GPR62 in neural tissues presents challenges due to antibody specificity concerns. A multi-faceted approach is recommended:

• In situ RNA hybridization: Generate DIG-labeled antisense probes for Gpr62 and perform in situ hybridization on fixed tissue sections . This allows detection of mRNA expression patterns independent of antibody reliability.

• AAV-mediated expression of tagged GPR62: Utilize adeno-associated virus vectors to express epitope-tagged versions of GPR62 (HA, FLAG, etc.) in vivo . This approach allowed researchers to determine that GPR62 is selectively expressed on the adaxonal myelin layer.

• Comparative immunostaining: Always include GPR62 knockout tissues as negative controls, alongside positive controls (tissues known to express GPR62, such as mature oligodendrocytes) .

• qRT-PCR validation: Complement protein detection with quantitative PCR using primers specific for Gpr62 (e.g., TTTATCCTGGCGGTTCTCGTA and TGCGCTAAGTAGAAGGCATCTTG) .

• Sample preparation optimization: For Western blot applications, avoid standard denaturation conditions (95°C, 10 min) which can cause GPR62 to form undetectable aggregates. Instead, use 55°C for 15 min or room temperature for 16 hours .

What explains the discrepancy between GPR62's potential role in axo-myelinic signaling and the normal phenotype of GPR62 knockout mice?

This apparent contradiction requires careful analysis of several considerations:

• Functional redundancy: The most likely explanation is functional redundancy with related receptors. GPR61, which shares signaling properties with GPR62, is expressed in overlapping regions of the brain and could compensate for GPR62 deficiency . Both receptors show constitutive activity on the cAMP pathway and are expressed in similar cell types.

• Subtle phenotypes: While gross myelination appears normal in Gpr62 knockout mice, more subtle aspects of myelin or axoglial communications may be affected but not detected in standard analyses . Advanced techniques such as electrophysiological measurements, behavioral assessments under stress conditions, or aging studies might reveal phenotypes not apparent in basic characterization.

• Context-dependent importance: GPR62 may become critically important only under specific physiological challenges or pathological conditions not tested in standard knockout phenotyping.

• Developmental compensation: Knockout from embryonic stages may trigger developmental compensation mechanisms that mask the true function of GPR62. Conditional or inducible knockout approaches might reveal more pronounced phenotypes.

To resolve this discrepancy, researchers should consider generating Gpr61/Gpr62 double-knockout mice, which may show more severe phenotypes than single knockouts .

How can I distinguish between constitutive activity and potential endogenous ligand activation when studying GPR62 signaling?

Distinguishing between true constitutive activity and activation by unknown endogenous ligands presents a significant challenge when studying orphan receptors like GPR62. Several experimental approaches can help address this question:

• Serum-free assays: GPR62 maintains its ability to increase cAMP levels even in the absence of serum, suggesting true constitutive activity rather than activation by serum components .

• Heterologous expression systems: Using expression systems that are unlikely to produce the endogenous ligand (if one exists) can help isolate constitutive activity. The observation that GPR62 activates signaling across multiple cell types (HEK293 cells, PC-12 cells) supports constitutive activity .

• Inverse agonist screening: While no ligands are currently known for GPR62, screening for compounds that reduce its basal activity could identify inverse agonists. For the related receptor GPR61, 5-(nonyloxy)-tryptamine has been reported to inhibit constitutive activation .

• Mutagenesis studies: Introducing mutations in key residues can distinguish constitutive activity from ligand binding. For example, the A111D mutant of GPR62 could be tested for altered signaling properties, similar to approaches used with other GPCRs .

• Biased signaling analysis: Examining whether GPR62 activates multiple signaling pathways with different efficiencies can provide insights into its activation mechanism. GPR62 has been shown to activate both Gs/cAMP and Gq/IP1 pathways .

What are the optimal conditions for using anti-GPR62 antibodies in Western blot applications?

Based on published research, the following protocol optimizations are recommended for detecting GPR62 in Western blot applications:

It's worth noting that the apparent molecular weight of GPR62 may vary depending on denaturation conditions, with detectable bands typically appearing at 40-50 kDa under optimized conditions .

What strategies can overcome the lack of validated antibodies for studying endogenous GPR62?

When studying endogenous GPR62 in the absence of fully validated antibodies, researchers can employ several alternative strategies:

• Epitope tagging approaches: Generate epitope-tagged versions (HA, FLAG, etc.) of GPR62 and express them in cells or tissues of interest using viral vectors. This approach has been successfully used to determine the subcellular localization of GPR62 in oligodendrocytes .

• CRISPR/Cas9 knock-in of tags: Introduce epitope tags into the endogenous Gpr62 locus using CRISPR/Cas9 gene editing, allowing detection of the endogenously expressed receptor with well-validated anti-tag antibodies.

• RNA-based detection methods:

  • In situ hybridization with DIG-labeled antisense probes for Gpr62

  • Single-cell RNA sequencing to identify GPR62-expressing cell populations

  • qRT-PCR with validated primers (e.g., TTTATCCTGGCGGTTCTCGTA and TGCGCTAAGTAGAAGGCATCTTG)

• Functional assays: Measure downstream signaling events (cAMP production, IP1 levels, β-arrestin recruitment) in GPR62-expressing cells compared to knockout controls .

• Antibody validation strategy: If using commercial antibodies, validate them using multiple approaches:

  • Testing on GPR62-transfected versus mock-transfected cells

  • Confirming absence of signal in GPR62 knockout tissues

  • Peptide competition assays with the immunizing peptide

How can I design experiments to investigate potential functional redundancy between GPR62 and related orphan receptors?

To investigate functional redundancy between GPR62 and related receptors like GPR61, consider the following experimental design approaches:

• Comparative expression analysis:

  • Perform simultaneous in situ hybridization for Gpr61 and Gpr62 to determine co-expression in the same cell types

  • Use single-cell RNA sequencing to identify populations expressing both receptors

  • Compare developmental expression patterns of both receptors in tissues of interest

• Double knockout models:

  • Generate Gpr61/Gpr62 double-knockout mice to assess potential synergistic phenotypes

  • Use conditional knockout approaches to delete both genes in specific cell types or at defined developmental stages

  • Employ CRISPR/Cas9 to create double knockouts in relevant cell lines

• Rescue experiments:

  • Express GPR61 in GPR62-deficient cells/tissues to test functional complementation

  • Create chimeric receptors with domains from both GPR61 and GPR62 to identify functionally important regions

• Comparative signaling analysis:

  • Systematically compare signaling pathways activated by both receptors (Gs/cAMP, Gq/IP1, β-arrestin recruitment)

  • Use BRET/FRET approaches to monitor real-time signaling in cells expressing either or both receptors

  • Employ biased signaling analysis to identify potential differences in signaling profiles

• Cross-regulation studies:

  • Investigate whether GPR61 and GPR62 form heterodimers using co-immunoprecipitation or proximity ligation assays

  • Examine whether expression levels of one receptor affect the other through feedback mechanisms

Published data already suggests that GPR61 and GPR62 activate similar signaling pathways and have overlapping expression patterns in the brain, supporting potential functional redundancy .

What are the most promising approaches to identify endogenous ligands or modulators of GPR62?

Based on current knowledge of GPR62 and successful approaches with other orphan receptors, the following strategies are recommended for ligand identification:

• Reverse pharmacology screening:

  • Screen tissue extracts for their ability to modulate constitutive activity of GPR62

  • Focus on brain regions with high GPR62 expression (cerebral cortex, cerebellum, etc.)

  • Use high-throughput functional assays measuring cAMP or IP1 production

• Bioinformatic approaches:

  • Phylogenetic comparison with related receptors that have known ligands

  • Structure-based virtual screening once a GPR62 structure becomes available

  • Analysis of expression patterns to identify potential ligand sources

• Targeted screening:

  • Test compounds known to affect oligodendrocyte function or myelination

  • Screen lipid mediators given the location of GPR62 at the axon-myelin interface

  • Evaluate compounds affecting related orphan receptors like GPR61

• Investigation of inverse agonists:

  • Screen for compounds that reduce the constitutive activity of GPR62

  • The identification of 5-(nonyloxy)-tryptamine as an inverse agonist for the related GPR61 provides a starting point

• Functional metabolomics:

  • Compare metabolites in wild-type versus GPR62 knockout tissues

  • Use untargeted mass spectrometry to identify differential metabolites

The recent success in identifying an inverse agonist for the related orphan receptor GPR61 suggests that similar approaches might be productive for GPR62.

How might GPR62 antibodies be used to investigate its role in neurological disorders?

GPR62 antibodies could serve as valuable tools for investigating potential roles of this receptor in neurological conditions, particularly those involving oligodendrocyte function or myelination:

• Expression studies in disease models:

  • Compare GPR62 expression levels in tissues from multiple sclerosis, leukodystrophies, or other demyelinating disorders

  • Examine potential alterations in GPR62 localization during disease progression

  • Investigate whether GPR62 expression changes in response to remyelination therapies

• Mechanistic investigations:

  • Use anti-GPR62 antibodies to isolate and analyze GPR62-containing protein complexes from normal and diseased tissues

  • Identify potential binding partners that might be dysregulated in disease states

  • Examine post-translational modifications of GPR62 that might be altered in pathological conditions

• Therapeutic development:

  • Develop antibodies that could modulate GPR62 function (agonistic or antagonistic)

  • Use GPR62 antibodies to target therapeutic agents to oligodendrocytes

  • Screen for small molecules that alter GPR62 expression or localization

• Biomarker potential:

  • Investigate whether soluble forms of GPR62 exist in cerebrospinal fluid or blood

  • Assess whether GPR62 antibody reactivity patterns correlate with disease progression or treatment response

What experimental designs would best elucidate the specific role of GPR62 in axo-myelinic signaling?

To investigate the specific role of GPR62 in axo-myelinic signaling, the following experimental approaches would be most informative:

• High-resolution localization studies:

  • Use super-resolution microscopy with validated antibodies or epitope-tagged GPR62 to precisely map its distribution at the axon-myelin interface

  • Employ electron microscopy immunogold labeling to determine GPR62 localization at the ultrastructural level

  • Investigate co-localization with known components of axo-myelinic signaling complexes

• Conditional and cell-specific manipulations:

  • Generate oligodendrocyte-specific GPR62 knockout mice using Cre-lox technology

  • Create temporally controlled knockout models to distinguish developmental versus maintenance roles

  • Use viral expression of dominant-negative GPR62 forms in mature oligodendrocytes

• Functional signaling assays:

  • Develop co-culture systems with neurons and GPR62-expressing or GPR62-knockout oligodendrocytes

  • Use FRET/BRET sensors to monitor GPR62-mediated signaling at the axon-myelin interface in real-time

  • Assess calcium, cAMP, or other second messenger dynamics in response to axonal activity

• Electrophysiological approaches:

  • Compare conduction velocities in GPR62 knockout versus wild-type animals

  • Assess activity-dependent modulation of conduction in the presence or absence of GPR62

  • Investigate myelin plasticity in response to neuronal activity with or without GPR62

• Combined omics approaches:

  • Perform transcriptomic and proteomic analyses of wild-type versus GPR62-deficient myelin

  • Use proximity labeling techniques (BioID, APEX) with GPR62 as bait to identify interacting proteins specifically at the axon-myelin interface

  • Apply metabolomics to identify signaling molecules regulated by GPR62 activity

These approaches would help establish whether GPR62 plays a role in activity-dependent myelination, myelin maintenance, or metabolic support of axons by oligodendrocytes.