GRHL3 Antibody

What is GRHL3 and why is it significant in epidermal research?

GRHL3 is a member of the CP2-like transcription factor family that plays critical roles in tissue development and homeostasis. GRHL3 is essential for epidermal differentiation and barrier formation during embryonic development, particularly at the end of mouse embryogenesis . While GRHL3 appears dispensable for epidermal differentiation during adult skin homeostasis, it becomes critically important during barrier repair after epidermal injury .

The significance of GRHL3 in epidermal research stems from several key observations:

• GRHL3 deletion leads to decreased expression of multiple genes critical for barrier formation, including lipid processing enzymes, cell-cell adhesion molecules, and structural proteins

• In humans, dominant-negative GRHL3 mutations are associated with defective periderm development in Van der Woude syndrome

• GRHL3 is one of only 8 genes associated with both altered disease expression and psoriasis susceptibility loci

• GRHL3 is upregulated in psoriasis lesions, where its expression correlates with psoriasis-associated cytokine activity

• GRHL3 suppresses alarmin and other proinflammatory genes after immune injury, indicating its role in modulating inflammation

What are the optimal specimen preparation techniques for GRHL3 immunostaining?

For reliable GRHL3 immunostaining, consider the following methodological approaches:

Tissue Fixation and Processing:

• Fix tissues in 4% paraformaldehyde for 24-48 hours depending on sample size

• For skin samples, optimal fixation time is 24 hours to preserve epitope integrity

• Paraffin embedding should follow standard protocols with careful temperature monitoring

Antigen Retrieval Methods:

• Heat-induced epitope retrieval using citrate buffer (pH 6.0) has shown superior results

• Pressure cooking for 20 minutes followed by 20-minute cooling period

• For formalin-fixed tissues, enzymatic retrieval using proteinase K may be necessary for certain GRHL3 epitopes

Primary Antibody Considerations:

• Validated antibodies against GRHL3 should be used at concentrations of 1:100 to 1:500 depending on the specific antibody

• Overnight incubation at 4°C typically yields optimal signal-to-noise ratio

• Polyclonal antibodies may detect a broader range of GRHL3 isoforms than monoclonal variants

Critical Controls:

• GRHL3-knockout tissues serve as essential negative controls for antibody validation

• Embryonic skin at E16.5 provides a positive control for GRHL3 expression

• Sequential dilution series should be performed to identify optimal antibody concentration

How can GRHL3 antibodies be validated for specificity in experimental contexts?

Validation of GRHL3 antibodies is critical for experimental rigor. The following methodological approaches should be implemented:

Western Blot Validation:

• Confirm single band of appropriate molecular weight (~70 kDa)

• Include lysates from tissues known to express GRHL3 (embryonic skin, adult psoriatic lesions)

• Compare with recombinant GRHL3 protein as positive control

Knockout Model Validation:

• GRHL3-knockout tissues generated through CRISPR-Cas9 provide the gold-standard negative control

• Demonstrated absence of signal in knockout samples confirms specificity

• Recommended gRNA for GRHL3 knockout: GTAATCATAGAGGAAGCTCA

Cross-Reactivity Assessment:

• Test antibody against other grainyhead family members (GRHL1, GRHL2)

• Perform peptide competition assays to confirm epitope specificity

• If possible, test across species to confirm recognition of conserved epitopes

ChIP-seq Validation Approach:

• Compare ChIP-seq peaks with known GRHL3 binding motifs

• Confirm enrichment at established target genes such as KRT7, KRT8, KRT18, and TFAP2C

• Perform technical replicates to ensure reproducibility of binding profiles

What are the technical challenges in GRHL3 ChIP-seq experiments and how can they be overcome?

GRHL3 ChIP-seq experiments present several technical challenges that require specific methodological considerations:

Chromatin Preparation Challenges:

• Epithelial tissues require optimized crosslinking protocols (1% formaldehyde for 10 minutes)

• Excessive crosslinking can mask epitopes and reduce immunoprecipitation efficiency

• Insufficient shearing leads to poor resolution of binding sites

Antibody Selection and Validation:

• ChIP-grade antibodies must be specifically validated for immunoprecipitation

• Validation should include ChIP-qPCR at known target sites before proceeding to sequencing

• ChIP-seq antibody validation should include GRHL3 knockout tissues as negative controls

Peak Calling Considerations:

• GRHL3 binding sites show strong sequence conservation as measured by Phastcons

• FDR threshold of <0.05 is recommended for peak calling

• Replicate experiments are essential to identify high-confidence peaks (4,035 common peaks were identified between two independent biological experiments)

Integration with Expression Data:

• Correlate GRHL3 binding sites with gene expression changes in GRHL3-deleted conditions

• Consider condition-specific binding patterns as GRHL3 targets distinct gene sets during development versus repair

How do GRHL3 binding patterns differ between developmental and repair contexts?

GRHL3 exhibits dynamic and condition-dependent chromatin binding patterns:

Developmental Context (Embryonic):

• In E16.5 embryonic skin, GRHL3 targets genes essential for initial barrier formation

• Binding primarily occurs at genes involved in lipid processing, cell-cell adhesion, and structural proteins

• These developmental targets establish the foundation for proper epidermal barrier function

Repair Context (Adult):

• After wax stripping or immune-mediated damage (IMQ treatment), GRHL3 binds largely distinct genomic regions

• In psoriasis-like conditions, GRHL3 directly regulates 82 likely target genes including CNFN, ELF3, ELOVL7, IVL, and OVOL1

• GRHL3 actively suppresses alarmin and proinflammatory genes during repair processes

Comparative Analysis:

• ChIP-seq analysis revealed 4,035 GRHL3 peaks in E16.5 skin versus 4,820 peaks after wax stripping and 9,294 peaks after IMQ treatment

• The overlap between developmental and repair binding sites is significant but limited

• Repair-specific binding correlates with suppression of inflammatory pathways not active during development

This dynamic binding pattern suggests that while GRHL3 maintains its core function in promoting barrier integrity, it employs distinct molecular mechanisms during development versus repair of adult tissues.

What is the role of GRHL3 in cancer biology and how can it be studied?

GRHL3 exhibits complex roles in cancer biology that vary by tissue context:

Functional Role in Cancer Progression:

• Downregulation of GRHL3 promotes lung colonization and growth of LUSC cells

• GRHL3 silencing enhances multiple organ distant metastasis, including bone, brain, and liver

• Mechanistically, GRHL3 silencing stabilizes SOX2 via SIRT1-mediated decreases in acetylation and subsequent ubiquitination-dependent degradation

Methodological Approaches for Study:

• Generate stable GRHL3 knockdown or knockout cancer cell lines using shRNA or CRISPR-Cas9

• Assess metastatic potential through in vivo metastasis models

• Analyze anoikis resistance and cancer stem cell characteristics in vitro

• Examine GRHL3-SOX2-SIRT1 axis through co-immunoprecipitation and protein stability assays

How can researchers use GRHL3 antibodies to study its role in psoriasis pathophysiology?

GRHL3 has significant implications in psoriasis research that can be investigated using several approaches:

Expression Analysis in Psoriatic Lesions:

• GRHL3 is consistently upregulated 2.62-fold in psoriasis lesions compared to uninvolved skin across multiple independent datasets

• Patients with stronger GRHL3 upregulation show stronger upregulation of genes induced by IL-17 and IL-22

• Following successful treatment with biologics (anti-TNF, anti-IL-23, anti-IL-17R), GRHL3 expression decreases to levels similar to non-lesional controls

Target Gene Analysis in Psoriasis:

• Of 1,206 GRHL3-regulated genes in differentiating normal human keratinocytes, 312 are also differentially expressed in psoriasis lesions

• 47 genes contain proximal GRHL3 ChIP peaks and represent likely direct targets

• GRHL3 binding is enhanced at target genes like IVL in lesional epidermis compared to normal epidermis

Experimental Model Systems:

• Imiquimod (IMQ)-induced mouse model of psoriasis shows that GRHL3 deletion:

  • Enhances sensitivity to low-dose IMQ treatment

  • Results in increased epidermal hyperplasia and immune cell infiltration

  • Impairs repair of IMQ-induced pathology

  • Confers resistance to anti-IL-22 therapy

Recommended Methodological Approach:

• Compare GRHL3 expression between lesional, non-lesional, and healthy skin using immunohistochemistry

• Correlate GRHL3 levels with psoriasis disease severity scores

• Examine co-localization with inflammatory markers

• Track GRHL3 expression dynamics during treatment response

What controls are essential when studying GRHL3 knockout models?

When investigating GRHL3 knockout models, the following controls are essential:

Knockout Validation Controls:

• Genomic verification of CRISPR-Cas9 edits through sequencing

• Protein-level validation using Western blot with validated antibodies

• mRNA expression analysis by qRT-PCR using primers spanning the deleted region

• Immunohistochemical confirmation of protein absence in tissues of interest

Phenotypic Assessment Controls:

• Include wild-type littermates as primary controls

• For conditional knockouts, include both Cre-negative and floxed-negative controls

• When using inducible systems, include vehicle-treated controls

Functional Validation Approaches:

• Known GRHL3 target genes should show expected expression changes:

  • Decreased expression of KRT7, KRT8, KRT18, KRT19, TFAP2C, and GRHL2 in SE cells

  • Upregulation of neural genes like PAX6, CDH2, and EPHA7 in SE cells

• ATAC-seq should show decreased chromatin accessibility around SE identity gene loci

• Epithelial-like morphology should be lost in GRHL3-knockout differentiated cells

Rescue Experiments:

• Re-expression of GRHL3 should rescue the knockout phenotype

• Structure-function studies using mutant GRHL3 constructs can identify critical domains

• Inducible expression systems allow temporal control of rescue

How can researchers effectively analyze GRHL3 binding to chromatin?

Effective analysis of GRHL3 chromatin binding requires integrated computational and experimental approaches:

Peak Calling and Quality Control:

• Use established peak calling algorithms (MACS2) with FDR < 0.05

• Assess peak reproducibility between biological replicates

• Evaluate peak quality using metrics like signal-to-noise ratio and peak shape

Motif Analysis and Annotation:

• Perform de novo motif discovery to identify GRHL3 binding motifs

• Compare identified motifs with known GRHL3 consensus sequences

• Annotate peaks relative to genomic features (promoters, enhancers, etc.)

Integration with Expression Data:

• Correlate GRHL3 binding with gene expression changes in GRHL3 knockout/knockdown experiments

• Identify direct target genes by filtering for genes with proximal GRHL3 binding (+10kb to -5kb of TSS)

• Pathway analysis of GRHL3-bound genes reveals biological processes (e.g., epidermal differentiation, response to wounding, immune response, lipid transport)

Condition-Specific Binding Analysis:

• Compare GRHL3 binding profiles across different conditions:

  • Embryonic epidermal differentiation (E16.5)

  • Adult repair (after wax stripping)

  • Inflammatory conditions (after IMQ treatment)

• Identify condition-specific and shared binding sites

• Analyze chromatin state at binding sites using histone modification ChIP-seq data

What approaches can be used to study GRHL3's effect on chromatin accessibility?

GRHL3 functions as a pioneer factor that can open chromatin. The following methodological approaches are recommended:

ATAC-seq Experimental Design:

• Compare chromatin accessibility in wild-type versus GRHL3 knockout cells

• GRHL3 knockout cells show substantially decreased chromatin accessibility around SE identity gene loci

• Analyze accessibility changes following induced GRHL3 expression in TetO-GRHL3 systems

Chromatin Accessibility Analysis:

• GRHL3 induction increases ATAC-seq signals at key target gene loci (KRT7, KRT8, KRT18, TFAP2C)

• Transcription factor motif enrichment analysis for differentially accessible regions reveals:

  • Increased binding of GRHL, AP2, and GATA families

  • Decreased binding of pluripotency-associated factors

Combined ChIP-seq and ATAC-seq Approach:

• Overlap GRHL3 binding sites with accessibility changes

• Identify direct targets where GRHL3 binding correlates with increased accessibility

• Compare accessibility profiles across developmental stages and conditions

Functional Validation:

• Use reporter assays with GRHL3-bound regulatory elements

• Perform site-directed mutagenesis of GRHL3 binding motifs

• Time-course analysis of GRHL3 binding and subsequent accessibility changes

What methodological approaches are recommended for studying GRHL3 in embryonic development?

Studying GRHL3 in embryonic development requires specialized approaches:

Embryonic Tissue Collection and Processing:

• For mouse studies, E16.5 represents a critical timepoint for GRHL3 activity in epidermal development

• Careful dissection and fixation protocols are essential for preserving tissue architecture

• Fresh-frozen samples should be prepared for molecular analyses (ChIP-seq, RNA-seq)

Developmental Time-Course Analysis:

• Examine GRHL3 expression and chromatin binding across multiple developmental stages

• Compare with expression patterns of known target genes

• Correlate with barrier acquisition milestones

Lineage-Specific Analysis:

• GRHL3 is particularly important in surface ectoderm (SE) commitment

• GRHL3 can drive acquisition of SE phenotype in stem cells

• TetO-GRHL3+ cells can differentiate into keratinocytes expressing KRT5, KRT14, and TP63

Functional Assessment:

• Barrier function tests (e.g., dye penetration assays) should be performed

• Morphological analysis should include epithelial structure and polarity

• Expression of barrier-related genes should be comprehensively assessed

How can researchers quantify GRHL3 expression changes during disease progression?

Quantifying GRHL3 expression changes requires multifaceted approaches:

Quantitative RT-PCR:

• Design primers specific to GRHL3 conserved regions

• Use GAPDH as normalization control

• Compare expression levels across disease states and treatment conditions

Western Blotting Quantification:

• Use validated antibodies against GRHL3

• Include loading controls (β-actin, GAPDH)

• Use densitometry for quantitative analysis

Immunohistochemical Quantification:

• Establish standardized staining protocols

• Use digital image analysis for quantification

• Measure both intensity and distribution of GRHL3 expression

What is the relationship between GRHL3 and other transcription factors in epithelial differentiation?

GRHL3 functions within a complex transcriptional network:

Regulatory Relationships:

• GRHL3 promotes expression of other transcription factors including TFAP2C and GRHL2

• GRHL3 binds to regulatory regions of these factors, suggesting direct regulation

• This transcriptional network collectively drives surface ectoderm commitment

Cooperative Binding:

• Transcription factor motif analysis reveals co-enrichment of GRHL, AP2, and GATA family binding sites

• These factors likely function cooperatively to establish epithelial identity

• Sequential ChIP experiments can identify co-occupancy at regulatory regions

GRHL3 Target Gene Classes:

• GRHL3 regulates genes involved in epithelium development, extracellular matrix organization, and epithelium morphogenesis

• In cancer contexts, GRHL3 influences SOX2 stability via SIRT1-mediated mechanisms

• Different transcription factor partnerships may explain context-specific target selection

Methodological Approach for Network Analysis:

• Perform ChIP-seq for multiple transcription factors

• Identify regions of co-occupancy

• Correlate with gene expression data

• Validate with perturbation experiments

How do experimental conditions affect GRHL3 antibody performance?

Experimental conditions significantly impact GRHL3 antibody performance:

Fixation Effects:

• Overfixation can mask epitopes and reduce antibody binding

• Underfixation may result in tissue degradation and false negatives

• Optimal fixation: 4% paraformaldehyde for 24 hours for most tissues

Antibody Concentration Optimization:

• Titrate antibodies to determine optimal working concentration

• Typically 1:100-1:500 dilution for immunohistochemistry

• Higher concentrations may be needed for ChIP applications

Incubation Conditions:

• Temperature affects binding kinetics and specificity

• Overnight incubation at 4°C generally yields optimal results

• Room temperature incubations may increase background

Buffer Composition Considerations:

• pH significantly impacts epitope-antibody interactions

• Blocking agents should be optimized to reduce non-specific binding

• Detergent concentration affects membrane permeability and background

Batch Variation:

• Different antibody lots may show performance variation

• Validation with positive and negative controls should be performed for each lot

• Consider creating reference sample sets for standardization

What methodological approaches can detect alterations in GRHL3 function during disease states?

Multiple methodological approaches can assess altered GRHL3 function in disease:

Integrated ChIP-seq and RNA-seq Analysis:

• Compare GRHL3 binding profiles between healthy and diseased tissues

• Identify differential binding and correlate with expression changes

• GRHL3 binding to IVL is enhanced in lesional epidermis compared to normal epidermis

Post-translational Modification Analysis:

• Assess phosphorylation, acetylation, or other modifications using specific antibodies

• Modifications may alter GRHL3 activity without changing expression levels

• Mass spectrometry can identify novel modification sites

Protein-Protein Interaction Studies:

• Co-immunoprecipitation to identify altered interaction partners in disease

• Proximity ligation assays for in situ visualization of protein complexes

• In cancer, assess interactions with the SOX2-SIRT1 axis

Functional Activity Assays:

• Reporter assays with GRHL3-responsive elements

• Assess transcriptional activation potential in different disease contexts

• Binding affinity measurements using techniques like microscale thermophoresis