GH1 Antibody

What is GH1 and what is its role in human physiology?

GH1, also known as Growth Hormone 1, GH-N, or Somatotropin, belongs to the somatotropin/prolactin family of proteins. GH1 plays a fundamental role in growth control through multiple mechanisms. Its primary function is stimulating the liver and other tissues to secrete IGF-1 (Insulin-like Growth Factor 1). Additionally, GH1 directly stimulates both differentiation and proliferation of myoblasts while enhancing amino acid uptake and protein synthesis in muscle and other tissues .

The protein has a calculated molecular weight of 25 kDa (217 amino acids), though it is typically observed at approximately 22 kDa in experimental settings . GH1 is primarily produced by somatotroph cells in the anterior pituitary gland and is critical for normal growth and metabolic processes.

What applications are GH1 antibodies typically used for in research?

GH1 antibodies serve multiple research applications with different optimization parameters:

These applications allow researchers to study GH1 expression patterns, localization, and alterations in various physiological and pathological conditions .

What is the difference between polyclonal and monoclonal GH1 antibodies?

The choice between polyclonal and monoclonal GH1 antibodies depends on specific research requirements:

Monoclonal antibodies like AE00275 undergo rigorous specificity testing against >19,000 human proteins and show no cross-reactivity with closely related proteins such as CSH1, CSHL1, and CSH2 . This makes them particularly valuable for studies requiring definitive GH1 identification.

What are the optimal sample preparation techniques for GH1 detection in different tissue types?

Sample preparation varies significantly based on application and tissue type:

For Immunohistochemistry:

• For human pituitary: Formaldehyde fixation, paraffin embedding followed by epitope retrieval through boiling at pH6 for 10-20 minutes with 20 minutes cooling period

• For human placenta: Antigen retrieval with TE buffer pH 9.0 is recommended, with citrate buffer pH 6.0 as an alternative

• Incubation conditions: 1-2μg/ml antibody concentration for 30 minutes at room temperature

For Western Blot:

• Standard protein extraction protocols from human placenta tissue

• Dilution range of 1:500-1:2000 for optimal detection

• Expected molecular weight observation at approximately 22 kDa

For genetic detection of GH1:

• Genomic DNA extraction from blood samples

• PCR with specific primers (F: CTAAGGAGCTCAGGGTTTTTCC and R: GGAATGAATACTTCTGTTCCTTTGG) targeting exon 3

• Annealing temperature of 63°C, producing 169 bp amplicons

How can I validate the specificity of a GH1 antibody in my experimental system?

Comprehensive validation should employ multiple approaches:

• Protein Array Screening:

  • The gold standard involves testing against large protein arrays (>19,000 human proteins)

  • Z-score analysis quantifies binding specificity to GH1 versus other proteins

• Cross-reactivity Assessment:

  • Specifically test against closely related proteins (CSH1, CSHL1, CSH2)

  • BLAST search can identify potentially cross-reactive proteins

• Control Tissue Panel:

  • Positive controls: Human pituitary (somatotrophs) and placenta tissue

  • Negative controls: Tissues not expressing GH1

  • Antibody omission controls to assess background staining

• Molecular Weight Verification:

  • Confirm detection at the expected molecular weight (22-25 kDa)

  • Assess absence of non-specific bands at other molecular weights

• Genetic Correlation:

  • When possible, correlate antibody detection with genetic status (e.g., in GH1 deletion cases)

What are effective troubleshooting strategies for weak GH1 signals in immunohistochemistry?

When encountering weak signals in IHC applications, implement these systematic approaches:

For human pituitary samples specifically, the recommended concentration for the AE00275 monoclonal antibody is 1-3μg/ml with DAB staining by HRP polymer after appropriate epitope retrieval .

What approaches minimize cross-reactivity with GH1-related proteins in sensitive applications?

Cross-reactivity with related proteins (particularly CSH1, CSHL1, and CSH2) can be mitigated through:

• Monoclonal Antibody Selection:

  • Monoclonal antibodies like AE00275 demonstrate superior specificity through comprehensive validation

  • Z-score analysis quantifies specificity: an antibody is considered specific when it has an S-score of at least 2.5

• Epitope-Targeted Approach:

  • Select antibodies targeting epitopes unique to GH1 and not conserved in related proteins

  • Sequence alignment analysis can identify low-conservation regions

• Validation in Complex Samples:

  • Test in tissues expressing both GH1 and related proteins (e.g., placenta)

  • Use genetic models with confirmed GH1 deletion as controls

• Pre-absorption Controls:

  • Pre-incubate antibody with recombinant related proteins

  • Specific binding should be unaffected by pre-absorption with non-target proteins

When absolute specificity is required, comprehensively validated monoclonal antibodies with demonstrated lack of cross-reactivity to CSH1, CSHL1, and CSH2 provide the most reliable results .

How can I optimize multiplex immunoassays incorporating GH1 antibodies?

Successful multiplex strategies with GH1 antibodies require careful consideration of:

• Species Compatibility:

  • Pair mouse monoclonal GH1 antibodies (e.g., AE00275) with rabbit antibodies for other targets

  • Use directly conjugated primaries for maximum flexibility

• Signal Balancing:

  • Titrate individual antibodies to achieve balanced signal intensity

  • Consider signal amplification for low-abundance targets

• Sequential Protocol Development:

  • Test optimal antigen retrieval conditions for all targets

  • Determine if sequential or simultaneous antibody application works best

  • For pituitary tissue, boiling at pH6 for 10-20 minutes works well for GH1 detection

• Cross-Reactivity Prevention:

  • Include absorption controls to prevent non-specific binding

  • Validate each antibody individually before combining

• Advanced Detection Strategies:

  • Consider tyramide signal amplification for improved sensitivity

  • Spectral unmixing can resolve closely overlapping signals

What considerations are important when using GH1 antibodies in growth hormone deficiency studies?

For studies of conditions like Isolated Growth Hormone Deficiency IA (IGHD IA), which is inherited in an autosomal recessive manner due to GH1 gene deletions , researchers should consider:

• Genetic-Protein Correlation:

  • Understand the genetic basis of deficiency (deletion vs. mutation)

  • Complement antibody detection with genetic testing (WES, targeted sequencing)

  • Use real-time PCR for copy number analysis of GH1 exons

• Epitope Accessibility:

  • Ensure antibody epitope is not within deleted regions

  • Consider multiple antibodies targeting different regions

  • For the delta-delta CT method in PCR analysis, use appropriate reference genes (e.g., ALB)

• Quantification Methods:

  • Implement calibrated quantitative approaches for partial deficiencies

  • Use the delta-delta CT method for relative quantification in genetic testing

  • Include appropriate controls (age-matched, family members)

• Sample Selection:

  • Focus on pituitary tissue when possible (primary GH1-producing site)

  • Consider developmental timing in pediatric studies

  • Use familial controls for genetic forms of deficiency

The combination of antibody-based protein detection and genetic characterization provides the most comprehensive assessment of GH1 deficiency conditions.

How do structural considerations in antibody design affect GH1 antigen binding?

Recent advances in antibody design highlight the importance of structure-function relationships in GH1 antibody development:

• Structure-Guided Optimization:

  • Joint modeling of sequence and structure dependencies improves antibody specificity

  • Complementarity-determining regions (CDRs), particularly in the heavy chain (H1, H2, H3), are critical for antigen recognition

• Computational Assessment:

  • Antibody structures can be validated using computational tools like AlphaFold2

  • RMSD (Root Mean Square Deviation) analysis quantifies structural quality

  • Over 70% of properly designed antibody structures exhibit RMSD values below 2

• Binding Energy Optimization:

  • Optimization of binding energy improves antibody-antigen interactions

  • IMP (the percentage of designed CDRs with lower binding energy than original) serves as a quality metric

• CDR-specific Inpainting:

  • Antigen-specific CDR generation models can optimize binding regions

  • Different CDRs contribute differently to antigen binding (H3 typically most important)

Advanced antibody design approaches can generate diverse, high-quality antibodies through joint modeling of structures and sequences, particularly in critical binding regions .

What are the considerations for storing and handling GH1 antibodies to maintain optimal performance?

Proper storage and handling are critical for maintaining antibody performance:

Following these storage recommendations ensures consistent antibody performance across experiments and maximizes shelf life .

How can I assess antibody efficacy in detecting various GH1 isoforms or genetic variants?

When working with GH1 variants, particularly in clinical research contexts:

• Epitope Mapping:

  • Determine if the antibody epitope overlaps with known variant regions

  • Consider using multiple antibodies targeting different regions of GH1

• Genetic Characterization:

  • Employ PCR-based methods to identify gene deletions

  • For exon-specific detection, use primers targeting specific regions (e.g., exon 3)

  • Complement with Whole Exome Sequencing for comprehensive variant identification

• Validation in Variant Samples:

  • Test antibody in samples with confirmed genetic variants

  • Compare detection between wild-type and variant GH1

  • Consider quantitative approaches for partial expression

• Alternative Detection Methods:

  • For variants affecting protein structure, mass spectrometry can provide isoform identification

  • Combine antibody-based detection with genetic testing for comprehensive analysis

The combination of genetic characterization and targeted antibody approaches provides the most complete picture when studying GH1 variants associated with conditions like IGHD IA .