GSK3A Antibody

What is the difference between GSK3α and GSK3β?

GSK3α and GSK3β are closely related isoforms that differ in several key aspects:

• Molecular Weight: GSK3α is approximately 51 kDa while GSK3β is approximately 46-47 kDa

• Functional Redundancy: While sharing similarities, knockout studies reveal distinct biological roles, with some lymphoma cell lines tolerating GSK3α deletion but not GSK3β deletion

• Structural Differences: GSK3α contains an N-terminal glycine-rich extension that is absent in GSK3β

• Phosphorylation Sites: While both can be phosphorylated at serine residues (Ser21 for GSK3α and Ser9 for GSK3β), the regulation dynamics may differ

For experimental discrimination, western blot analysis can effectively distinguish between the two isoforms based on their different molecular weights when using appropriate antibodies and gel conditions that provide sufficient resolution.

What applications are validated for GSK3α antibodies?

GSK3α antibodies have been validated for multiple research applications:

When selecting an antibody, researchers should verify that it has been validated for their specific application and consider whether monoclonal (higher specificity) or polyclonal (potentially higher sensitivity) antibodies are more appropriate for their experimental design.

What species reactivity should be considered when selecting GSK3α antibodies?

Based on product information across multiple vendors:

• Most commercially available antibodies react with human GSK3α

• Many antibodies offer cross-reactivity with mouse and rat orthologs

• Some antibodies additionally cross-react with monkey GSK3α

• Species-specific antibodies may be necessary for specialized applications

When working with non-human models, it's essential to verify the antibody's cross-reactivity with your species of interest. For example, search result noted that a particular GSK3α antibody does not react with murine GSK3α, which limited their assessment of GSK3α-PKAc association in NIH 3T3 cells.

How is GSK3α regulated in cellular signaling pathways?

GSK3α activity is regulated through multiple mechanisms:

• Phosphorylation: Serine 21 phosphorylation inactivates GSK3α

• Protein-Protein Interactions: GSK3α forms complexes with regulatory proteins such as PKAc (protein kinase A catalytic subunit)

• Subcellular Localization: Changes in localization can affect access to substrates

• Pathway Integration: GSK3α functions in multiple pathways including Wnt signaling

Experimental approach: To study GSK3α regulation, researchers commonly use phospho-specific antibodies to detect its phosphorylation state, co-immunoprecipitation to identify interacting partners, and subcellular fractionation to determine localization patterns.

How can researchers ensure specificity when targeting GSK3α versus GSK3β in experiments?

Achieving isoform specificity remains challenging:

• Genetic Approaches: CRISPR/Cas9-mediated knockout of specifically GSK3α as demonstrated in lymphoma cell lines

• Chemical-Genetic Strategy: As described in search result , this approach achieves specific and individual inhibition of each isoform

• Isoform-Specific Antibodies: Use antibodies raised against non-conserved regions between the isoforms

• siRNA Targeting: Design siRNAs targeting unique regions in GSK3α mRNA

Despite structural similarities, researchers can distinguish between isoforms by combining these approaches with careful validation. Note that most commercially available small molecule inhibitors do not effectively discriminate between GSK3α and GSK3β, as "no inhibitor is currently available that can well distinguish between the two isozymes" .

What are the optimal experimental approaches to study GSK3α phosphorylation?

To effectively study GSK3α phosphorylation:

• In vitro Kinase Assays: As described in search result , researchers can use immunoprecipitated GSK3α or purified GSK3α as a substrate in kinase assays

  • "PKA phosphorylation of GSK-3 was assessed by using a PKA assay kit... immunoprecipitated GSK-3α, immunoprecipitated HA-GSK-3β, purified GSK-3α (0.1 unit/reaction), or recombinant GSK-3β (5 units/reaction)... were used as substrates"

• Phospho-specific Antibodies: Use antibodies specifically recognizing phosphorylated Ser21 of GSK3α

• Phosphatase Treatment Controls: Include samples treated with phosphatases to confirm specificity of phospho-specific detection

• Cell Starvation: "HEK293 cells were starved in serum-free medium for at least 12 h before lysing to decrease the background phosphorylation level of GSK-3"

• Pharmacological Intervention: Use pathway-specific activators or inhibitors to modulate GSK3α phosphorylation status

What is the significance of GSK3α in lymphoma and cancer research?

GSK3α has emerged as an important cancer research target:

These findings suggest GSK3α as a potential therapeutic target in lymphoma, with its overexpression correlating with poorer clinical outcomes.

How does GSK3α contribute to immune evasion in cancer?

Recent research has revealed GSK3α's role in immune suppression:

• Neutrophil Recruitment: "Functional and mechanistic studies demonstrated that Gsk3a could inhibit CTL activity by inducing neutrophil chemotaxis and NETs formation"

• T-cell Suppression: GSK3α knockdown enhanced cytotoxic function of CTLs and decreased exhausted T cell populations

• Signaling Pathway: "Gsk3a affects leucine-rich α-2-glycoprotein 1 secretion via the nuclear factor kappa B/signal transducer and activator of transcription 3 (NFκB/STAT3) axis"

• Synergistic Therapy: "A significant synergistic effect was observed when Gsk3a inhibitor was in combination with anti-PD-1 antibody"

Experimental approach: To study GSK3α's immune evasion role, researchers can use CRISPR screening in immunocompetent and immunodeficient mouse models, flow cytometry to analyze immune cell infiltration and function, and RNA sequencing to identify downstream gene expression changes.

What methodologies are recommended for CRISPR/Cas9-mediated deletion of GSK3α?

For effective CRISPR/Cas9-mediated GSK3α knockout:

• Guide RNA Design: "Guide RNAs (gRNAs) for targeting the first coding exons of both GSK3α and GSK3β genes were designed using a Web tool (http://crispr.mit.edu/)"[3]

• Target Sequence: For GSK3α, the following gRNA sequence has been validated: "GACAGATGCCTTTCCGCCGC"

• Vector System: "The gRNA sequences were cloned into the px458 vector (Addgene) carrying a coexpressing GFP"

• Delivery Method: "The constructs were nucleofected into lymphoma cells using a nucleofection kit (Lonza, Basel, Switzerland)"

• Single-Cell Isolation: "Thirty-six hours postnucleofection, GFP-expressing single cells were sorted into 96-well plates at 1 cell per well on an FACSAria II sorter"

• Clone Validation: "After the expansion of single-cell subclones in culture for 2 weeks, each subclone was genotyped by PCR and Sanger's DNA sequencing"

This methodology provides a robust approach for generating GSK3α knockout cell lines for functional studies.

What are the current challenges in developing specific inhibitors for GSK3α versus GSK3β?

Despite the therapeutic potential, developing isoform-specific GSK3 inhibitors faces significant challenges:

• Structural Similarity: The catalytic domains of GSK3α and GSK3β share high homology, making selective targeting difficult

• Limited Success: "No inhibitor is currently available that can well distinguish between the two isozymes"

• Functional Overlap: "Understanding the mechanism by which GSK3α and GSK3β differentially regulate cellular processes could, in the future, facilitate the development of more specific drugs"

• Disease Specificity: "The role of individual GSK3 isozymes in the pathogenesis of these diseases is poorly defined"

Alternative approaches include chemical-genetic strategies that achieve isoform specificity through engineered kinase variants or targeting isoform-specific protein-protein interactions rather than the catalytic domain itself.

What controls should be included when working with GSK3α antibodies?

For robust experimental design with GSK3α antibodies:

• Positive Controls: Include lysates from cell lines known to express GSK3α (e.g., HeLa, HEK293, HT-29)

• Negative Controls:

  • GSK3α knockout cell lines generated by CRISPR/Cas9

  • Isotype control antibodies for flow cytometry and immunostaining

• Specificity Controls:

  • Pre-absorption with immunizing peptide

  • Detection of both GSK3α (51 kDa) and GSK3β (46 kDa) when using antibodies targeting conserved regions

• Loading Controls: Include housekeeping proteins (e.g., β-actin, GAPDH) for western blot normalization

• Phosphorylation Controls:

  • Serum-starved cells (low phosphorylation)

  • Stimulated cells (increased phosphorylation)

  • Phosphatase-treated samples

How can researchers address poor detection or specificity issues with GSK3α antibodies?

When troubleshooting GSK3α antibody issues:

• Poor Signal in Western Blotting:

  • Optimize protein loading (10-30 μg total protein typically sufficient)

  • Ensure proper transfer conditions for higher molecular weight proteins

  • Try longer primary antibody incubation (overnight at 4°C)

  • Use enhanced sensitivity detection systems for low abundance samples

• Specificity Concerns:

  • Validate with GSK3α knockout controls

  • Compare results with multiple antibodies targeting different epitopes

  • Use immunoblot buffer groups optimized for phospho-proteins

• High Background:

  • Increase blocking time/concentration

  • Optimize antibody dilution

  • Include additional washing steps

  • For phospho-detection, include phosphatase inhibitors in lysis buffers

• Cross-reactivity Issues:

  • Select antibodies raised against less conserved regions

  • Use monoclonal antibodies for higher specificity

  • Confirm specificity with knockout or knockdown controls

What factors should be considered when designing co-immunoprecipitation experiments with GSK3α?

For successful GSK3α co-immunoprecipitation:

• Lysis Conditions: Use buffers that preserve protein-protein interactions while efficiently extracting GSK3α

  • Search result describes successful co-immunoprecipitation of GSK3α and PKAc

• Antibody Selection: Choose antibodies validated for immunoprecipitation applications

  • "GSK-3α was immunoprecipitated from... untransfected HEK293 cells by using the GSK-3α-specific antibody"

• Expression Enhancement: "The amount of PKAc that coprecipitated with GSK-3α was enhanced by overexpression of GSK-3α in transiently transfected cells"

• Cross-linking Consideration: "The Western blots in panels 'd' and 'e' revealed the appearance of high molecular weight crosslinked bands, whose appearance depended on the application of the in vivo formaldehyde crosslinking step"

• Controls:

  • Include isotype control antibodies

  • Include vector-transfected controls: "PKAc was coprecipitated from HA-GSK-3β-transfected cells but not from control vector-transfected cells"

  • Consider the potential interference of antibody heavy chains (~50 kDa) with GSK3α detection (~51 kDa)

How can GSK3α be targeted for therapeutic development in cancer?

Recent research suggests multiple therapeutic strategies:

• Small Molecule Inhibitors: "Pharmacological inhibition of Gsk3a could enhance CTL function and further improve the efficacy of anti-PD-1 antibody"

• Combination Therapy: "A significant synergistic effect was observed when Gsk3a inhibitor was in combination with anti-PD-1 antibody"

• Biomarker Development: "Increased expression of Gsk3a was detected in anti-programmed cell death protein-1 (PD-1) antibody non-responsive patients"

• Targeting Downstream Pathways: "Gsk3a affects leucine-rich α-2-glycoprotein 1 secretion via the nuclear factor kappa B/signal transducer and activator of transcription 3 (NFκB/STAT3) axis"

These approaches provide promising avenues for therapeutic development targeting GSK3α in cancer, particularly in combination with immune checkpoint inhibitors.

What is the role of GSK3α in neurodegenerative diseases?

GSK3α plays a significant role in neurodegenerative disorders:

• Alzheimer's Disease: "GSK-3alpha regulates the production of amyloid-beta peptides, a major component of the plaques that accumulate with progression of Alzheimer's disease"

• Therapeutic Intervention: "Administration of therapeutic concentrations of lithium, a GSK-3 inhibitor, attenuates amyloid-beta production by specifically inhibiting the cleavage of amyloid precursor protein (APP) by gamma secretase, blocking accumulation of amyloid-beta peptides in the brains of mice that overproduce APP"

• Parkinson's Disease: "GSK3A is involved in Alzheimer and diabetes and GSK3B have been implicated in modifying risk of Parkinson disease"

Experimental approaches to study GSK3α in neurodegeneration include neuronal cell models, transgenic mouse models overexpressing or lacking GSK3α, and analysis of GSK3α activity in post-mortem brain tissue.

How can researchers differentiate between direct and indirect effects of GSK3α inhibition?

Distinguishing direct from indirect effects requires careful experimental design:

• Substrate Phosphorylation Analysis: Examine phosphorylation of direct GSK3α substrates using phospho-specific antibodies

• In Vitro Kinase Assays: Conduct kinase assays with purified components to confirm direct phosphorylation

• Temporal Analysis: Perform time-course experiments to distinguish immediate (likely direct) from delayed (likely indirect) effects

• Rescue Experiments: Express phospho-mimetic or phospho-deficient mutants of presumptive substrates to bypass GSK3α regulation

• Chemical-Genetic Approaches: Use analog-sensitive GSK3α mutants that can be specifically targeted by modified inhibitors

• Comparative Analysis: Compare effects of GSK3α inhibition with inhibition of downstream pathway components

This multi-faceted approach helps researchers distinguish between direct GSK3α targets and secondary effects resulting from pathway perturbation.