HADH Human

What is HADH and what is its primary function in human metabolism?

HADH (Hydroxyacyl-Coenzyme A dehydrogenase) is an enzyme belonging to the 3-hydroxyacyl-CoA dehydrogenase family that functions primarily in the mitochondrial matrix. It catalyzes the oxidation of straight-chain 3-hydroxyacyl-CoAs as part of the beta-oxidation pathway, with its enzymatic activity peaking with medium-chain-length fatty acids. HADH plays a critical role in fatty acid metabolism, participating in the step-wise breakdown of fats to convert them to energy. The enzyme is encoded by the HADH gene in humans and represents a key component of cellular energy production pathways .

What is the molecular structure and characteristics of human HADH?

The HADH gene is located on chromosome 4, specifically at position 4q22-q26, and contains 10 exons. The protein product is a 34.3 kDa polypeptide consisting of 314 amino acids with 124 observed peptides. When produced recombinantly with a His-tag, as is common in laboratory research, the protein contains 323 amino acids with a molecular mass of approximately 35.1 kDa. The recombinant protein is typically a single, non-glycosylated polypeptide chain. Structurally, the protein adopts a conformation that enables it to interact with its substrates, coenzymes, and potential regulatory proteins involved in metabolic pathways .

What synonyms and alternative designations exist for HADH in scientific literature?

Researchers should be aware of the multiple nomenclature used for HADH in scientific databases and literature, as this impacts comprehensive literature searches. The enzyme is known by several designations:

When conducting literature searches or database queries, researchers should include these alternative designations to ensure comprehensive coverage of relevant publications .

What are the optimal conditions for working with recombinant HADH protein in laboratory settings?

When working with recombinant HADH protein, researchers should maintain specific storage and handling conditions to preserve enzymatic activity. The protein should be stored at 4°C if the entire preparation will be used within 2-4 weeks. For longer-term storage, freezing at -20°C is recommended. The addition of a carrier protein (0.1% HSA or BSA) significantly enhances stability during long-term storage. Multiple freeze-thaw cycles should be strictly avoided as they can lead to protein denaturation and loss of catalytic activity. For experimental work, the recombinant HADH is typically prepared in a buffer containing 20mM Tris-HCl pH-8, 0.1M NaCl, and 20% glycerol, which helps maintain protein solubility and stability .

How can researchers design qPCR experiments to study HADH gene expression?

For quantitative PCR (qPCR) analysis of HADH gene expression, researchers should design experiments using validated primer pairs targeting the HADH transcript. Based on the reference sequence NM_005327, optimal forward and reverse primers are:

• Forward Sequence: TCCGTTGTCCACAGCACAGACT

• Reverse Sequence: GGAGGAAGTGTTGCTGGCAAAG

These primers should be reconstituted to a final concentration of 10 μM for use in qPCR reactions. The recommended PCR program includes: activation at 50°C for 2 min, pre-soak at 95°C for 10 min, followed by cycles of denaturation at 95°C for 15 sec and annealing at 60°C for 1 min. A melting curve analysis (95°C for 15 sec, 60°C for 15 sec, 95°C for 15 sec) should be performed to verify specificity. Researchers should include appropriate housekeeping genes for normalization and calculate relative expression using the ΔΔCt method. This approach allows for reliable quantification of HADH mRNA levels in different experimental conditions or across tissue samples .

What experimental design considerations are crucial when investigating HADH function in cellular models?

When designing experiments to study HADH function, researchers must carefully consider several key variables and controls. First, clearly define your independent variable (e.g., HADH expression levels, mutation status, or inhibitor concentration) and dependent variables (e.g., fatty acid oxidation rates, cellular ATP levels, or insulin secretion). Create a specific, testable hypothesis based on the known roles of HADH in fatty acid metabolism or its association with hyperinsulinemic hypoglycemia.

For genetic manipulation experiments:

• Design appropriate controls for gene knockdown or overexpression experiments

• Consider both acute and chronic effects of HADH modulation

• Validate knockdown or overexpression at both mRNA and protein levels

• Include rescue experiments to confirm specificity of observed phenotypes

For metabolic assays:

• Control for confounding variables such as cell density, passage number, and nutrient availability

• Include time-course experiments to capture dynamic metabolic responses

• Consider both basal and stimulated conditions when measuring related parameters

How do mutations in the HADH gene contribute to hyperinsulinemic hypoglycemia?

Mutations in the HADH gene lead to short-chain-L-3-hydroxyacyl-CoA dehydrogenase deficiency, which manifests clinically as hyperinsulinemic hypoglycemia. The mechanistic link between HADH deficiency and dysregulated insulin secretion involves protein-protein interactions with glutamate dehydrogenase (GDH). Research indicates that HADH normally exerts an inhibitory effect on GDH, which plays a critical role in amino acid-induced insulin secretion. When HADH is deficient or dysfunctional due to mutations, this inhibitory interaction is lost, resulting in unregulated GDH activity and consequently inappropriate insulin secretion.

This molecular mechanism explains why some patients with HADH mutations display protein-sensitive hypoglycemia. The dysregulation of insulin secretion in HADH deficiency exhibits an unpredictable and intermittent nature, which aligns with the observation that the hyperinsulinemia can sometimes be triggered by dietary protein intake. This protein sensitivity occurs because amino acids can stimulate insulin secretion via the GDH pathway, which becomes hyperactive in the absence of HADH's inhibitory effect. This relationship has been further validated in hadh knockout mouse models, confirming that the loss of inhibitory protein-protein interaction between HADH and GDH is central to the pathophysiology of hyperinsulinemic hypoglycemia in affected individuals .

What is the spectrum of mutations reported in HADH and their associated clinical presentations?

The HADH gene exhibits diverse mutation types associated with varying clinical manifestations. The literature documents several categories of mutations:

Most reported cases involve homozygous mutations, suggesting autosomal recessive inheritance. Clinical presentations are relatively consistent across patients, with symptom onset ranging from 1.5 hours after birth to 3 years of age. The predominant clinical features are hypoglycemia and seizures/convulsions directly related to the hypoglycemic state. Some patients present with protein-sensitive hypoglycemia, where dietary protein intake triggers hypoglycemic episodes. Other reported manifestations include hepatomegaly, coagulopathy, and occasionally myoglobinuria. The severity and specific presentation appear to correlate with the residual enzymatic activity resulting from the particular mutation. The relatively homogeneous clinical presentation across different mutations suggests a common pathological mechanism despite genetic heterogeneity .

What biochemical markers are reliable for diagnosing HADH deficiency, and how does the clinical state affect their reliability?

• Residual enzyme activity: Patients with mutations resulting in 35-50% residual activity may show normal acylcarnitine and organic acid profiles.

• Clinical state during sample collection: Samples collected during acute metabolic decompensation are more likely to show characteristic abnormalities compared to samples collected during compensated states.

• Disease progression: Some patients initially present with normal biochemical profiles but develop abnormalities over time, as documented in a patient who initially had normal profiles at 2 months but showed elevated urinary 3-hydroxybutyric acid and dicarboxylic aciduria when reassessed at 7 years.

• Environmental triggers: Certain conditions like fasting, protein loading, or catabolic stress may unmask biochemical abnormalities that are otherwise undetectable.

For comprehensive diagnosis, researchers and clinicians should consider analyzing both plasma acylcarnitines and urinary organic acids, preferably during periods of metabolic stress or after controlled provocative testing. Additionally, molecular genetic analysis of the HADH gene remains the gold standard for definitive diagnosis, particularly in cases with normal or borderline biochemical profiles .

How can researchers effectively investigate protein-protein interactions involving HADH in metabolic regulation?

Investigating protein-protein interactions of HADH, particularly with glutamate dehydrogenase (GDH), requires sophisticated biochemical and cell biology approaches. Researchers should employ multiple complementary techniques to establish and characterize these interactions:

• Co-immunoprecipitation (Co-IP) experiments using antibodies against HADH or potential interacting partners, followed by western blotting or mass spectrometry to identify co-precipitated proteins.

• Proximity ligation assays to visualize interactions in situ within cells, providing spatial information about where in the mitochondria these interactions occur.

• Förster resonance energy transfer (FRET) or bioluminescence resonance energy transfer (BRET) assays using tagged versions of HADH and potential partners to monitor interactions in live cells under various metabolic conditions.

• Yeast two-hybrid screening to identify novel interaction partners, followed by validation in mammalian systems.

• Recombinant protein production and in vitro binding assays to determine direct interactions and measure binding affinities.

When studying the HADH-GDH interaction specifically, researchers should examine how this interaction responds to various metabolic signals, such as amino acid availability, energy status, or insulin signaling. Comparative studies between wild-type HADH and disease-associated mutants can reveal how mutations affect these protein-protein interactions. Additionally, researchers should investigate whether post-translational modifications regulate these interactions under different physiological conditions. This multi-faceted approach can provide comprehensive insights into how HADH participates in metabolic regulation through protein-protein interactions .

What are the methodological challenges in correlating genotype-phenotype relationships in HADH deficiency?

Establishing clear genotype-phenotype correlations in HADH deficiency presents several methodological challenges that researchers must address through careful experimental design:

• Clinical heterogeneity: Despite relatively consistent presentation of hyperinsulinemic hypoglycemia, the severity, age of onset, and specific biochemical abnormalities vary considerably among patients with different HADH mutations. Researchers should develop standardized assessment protocols to compare phenotypes across studies.

• Rarity of the condition: With only a handful of reported cases in the literature, sample sizes are inherently small, limiting statistical power. International collaborations and patient registries are essential to aggregate sufficient data for meaningful analysis.

• Environmental influences: The phenotypic expression of HADH deficiency appears to be influenced by environmental factors such as diet and metabolic stress, which are difficult to control for in retrospective analyses. Prospective studies with controlled dietary interventions may help isolate these effects.

• Residual enzyme activity: The relationship between specific mutations, residual enzyme activity, and clinical presentation is complex. Researchers should conduct functional studies of each mutation to quantify its impact on enzyme activity and stability.

• Biochemical variability: The intermittent nature of biochemical abnormalities makes them unreliable markers for severity assessment. Longitudinal monitoring with multiple sampling points may be necessary to capture the full biochemical phenotype.

To overcome these challenges, researchers should adopt a comprehensive approach that combines clinical phenotyping, biochemical characterization, molecular genetic analysis, and functional studies of mutant proteins. This integrated approach will provide more robust evidence for genotype-phenotype correlations and improve our understanding of the pathophysiological mechanisms underlying HADH deficiency .

How can advanced molecular tools like CRISPR be applied to study HADH function?

CRISPR/Cas9 technology offers powerful approaches for investigating HADH function through precise genetic manipulation. Researchers can implement several strategic applications:

• Gene knockout models: Complete ablation of HADH expression in cellular or animal models can reveal the essential functions of this enzyme. When designing knockout strategies, researchers should target early exons to ensure complete loss of function and include appropriate controls to verify knockout efficiency at both mRNA and protein levels.

• Knock-in of patient mutations: Introducing specific patient-derived mutations using homology-directed repair allows researchers to recapitulate disease-associated variants in cellular models. This approach enables direct comparison between different mutations and wild-type HADH under controlled conditions.

• Domain-specific modifications: Targeted modifications of functional domains can help dissect which regions of HADH are responsible for specific activities, such as catalytic function versus protein-protein interactions with regulatory partners like glutamate dehydrogenase.

• Inducible expression systems: Combining CRISPR with inducible promoters allows temporal control over HADH expression, enabling studies of acute versus chronic effects of HADH deficiency.

• Tagged variants for localization studies: Introducing fluorescent or affinity tags via CRISPR enables tracking of HADH localization and protein-protein interactions in living cells.

When implementing these approaches, researchers should carefully design guide RNAs to minimize off-target effects, incorporate appropriate selection markers for efficient isolation of modified cells, and validate all genetic modifications through sequencing. Additionally, researchers should conduct complementary rescue experiments to confirm that observed phenotypes are specifically due to HADH modification rather than off-target effects. These advanced molecular tools provide unprecedented precision in studying HADH function in relevant biological contexts .

How should researchers interpret conflicting data on HADH biochemical markers across different studies?

When confronted with conflicting data regarding HADH biochemical markers, researchers should implement a systematic analytical approach. The discrepancies observed in acylcarnitine profiles and organic acid excretion patterns among HADH-deficient patients likely reflect underlying biological variables rather than methodological inconsistencies. To properly interpret these discrepancies, consider:

• Mutation severity correlation: Analyze the relationship between specific mutations and their impact on enzyme activity. Patients with mutations resulting in minimal residual activity (e.g., homozygous nonsense mutations or deletions causing frameshift) more consistently display characteristic biochemical abnormalities compared to those with mutations allowing 35-50% residual activity.

• Clinical state assessment: Recognize that sample timing relative to metabolic state significantly influences biomarker detection. Samples collected during metabolic decompensation frequently show abnormalities that may be absent during compensated states. Document and account for the patient's clinical condition, fasting status, and recent dietary intake when interpreting biochemical results.

• Longitudinal patterns: Consider that some patients may display normal profiles initially but develop biochemical abnormalities over time. A single normal result does not definitively exclude HADH deficiency, particularly in younger patients.

• Methodological standardization: When comparing studies, assess differences in analytical methods including sample preparation, instrumentation sensitivity, and reference ranges. Modern tandem mass spectrometry offers greater sensitivity than older techniques, potentially explaining some historical discrepancies.

Rather than viewing conflicting data as problematic, researchers should interpret these variations as informative about the dynamic nature of the disorder and use them to develop more nuanced diagnostic algorithms that incorporate multiple assessment points and genetic confirmation .

What are the most promising future research directions for HADH in metabolic disease understanding and therapeutics?

Several promising research directions emerge from our current understanding of HADH biology that merit focused investigation:

• Regulatory networks: Exploring the broader regulatory network surrounding HADH function, particularly its interactions with other metabolic enzymes and signaling pathways, could reveal new therapeutic targets. Research should focus on identifying and characterizing additional protein-protein interactions beyond the established HADH-GDH relationship.

• Tissue-specific functions: Investigating tissue-specific roles of HADH, especially in pancreatic beta cells versus liver and muscle, may explain the predominant insulin dysregulation phenotype despite the enzyme's ubiquitous expression. Tissue-specific knockout models would be valuable for this research direction.

• Metabolic flexibility: Examining how HADH contributes to metabolic flexibility—the ability to switch between different energy substrates—could provide insights into its role in metabolic diseases beyond congenital hyperinsulinism, potentially including diabetes and obesity.

• Small molecule modulators: Developing specific small molecule inhibitors or activators of HADH could serve as both research tools and potential therapeutic agents. High-throughput screening approaches coupled with structural biology insights should guide this development.

• Personalized therapy approaches: Investigating mutation-specific therapeutic strategies, such as read-through compounds for nonsense mutations or specialized dietary interventions based on specific metabolic blockages, represents a promising avenue for personalized medicine.

• Novel biomarker identification: Utilizing untargeted metabolomics to identify novel biomarkers that might be more consistently altered in HADH deficiency could improve diagnostic reliability across varying clinical states.

These research directions, particularly when pursued in parallel with complementary methodologies, hold significant promise for advancing our understanding of HADH's role in metabolic regulation and developing targeted therapeutic approaches for associated disorders .