HAVCR1 Human, HEK

What is HAVCR1 and what are its primary functions in human biology?

Beyond its immunological functions, HAVCR1 serves as a receptor for multiple viruses including Hepatitis A, Ebola, Marburg, Dengue, and Zika viruses, making it a significant player in viral pathogenesis . The protein also regulates the expression of various anti-inflammatory cytokines and co-inhibitory ligands including IL-10, and acts as a regulator of T-cell proliferation. In pathological contexts, HAVCR1 has been implicated in kidney injury and repair processes, as well as cancer progression pathways .

How does HAVCR1 function as a viral receptor in experimental models?

HAVCR1 serves as a receptor for multiple viruses through distinct mechanisms that can be studied in experimental systems. For Hepatitis A virus, HAVCR1 functions as a direct cellular receptor, facilitating viral entry into host cells. For Ebola and Marburg viruses, HAVCR1 operates through a dual mechanism: it binds exposed phosphatidylserine on the virion membrane and also interacts directly with envelope glycoprotein GP in the case of Ebola virus .

In Dengue virus research models, HAVCR1 binds exposed phosphatidylserine on the virion membrane, and studies have demonstrated that HAVCR1 and Dengue virus are co-internalized during viral entry. For Zika virus, HAVCR1 acts as a receptor by binding to the envelope protein E . Researchers investigating HAVCR1's role in viral entry can utilize HEK293 expression systems with fluorescently tagged viruses to track internalization dynamics and colocalization patterns.

What techniques are available for detecting HAVCR1 protein in human samples?

Multiple validated techniques are available for detecting HAVCR1 protein in human samples, each with specific applications in research settings. Immunodetection methods include Western blotting, immunofluorescence, and immunohistochemistry, with several validated antibodies commercially available .

For Western blotting, use standard protocols with antibodies such as Anti-TIM-1 Antibody (ABF199) or Anti-TIM-1 antibody (SAB3500252), which have been validated for human HAVCR1 detection . For immunofluorescence, cells should be fixed with 100% ice-cold ethanol, permeabilized with 0.1% Triton X-100 (timing dependent on the protein of interest), and blocked using 7.5% donkey serum in PBS . Antibodies should be used according to manufacturer's instructions, and slides mounted with FluorSave and visualized using fluorescence microscopy.

For quantitative detection, ELISA kits specifically designed for human HAVCR1 are available (e.g., RAB0743) . These provide a more precise quantification of HAVCR1 levels in serum, plasma, or cell culture supernatants. For tissue samples, immunohistochemical staining protocols using specific antibodies can reveal HAVCR1 localization patterns .

How can researchers effectively modulate HAVCR1 expression in HEK cell systems?

For modulating HAVCR1 expression in HEK cell systems, researchers can employ both knockdown and overexpression approaches, which provide complementary insights into HAVCR1 function. For knockdown studies, RNA interference using siRNA or shRNA represents an effective strategy. Specific siRNA sequences can be designed using proprietary algorithms, and validated collections of shRNA are commercially available .

For overexpression studies in HEK cells, researchers should consider using expression vectors with strong promoters (such as CMV) and appropriate selection markers for generating stable cell lines. The search results indicate that recombinant HAVCR1 expressed in HEK 293 cells is available as a research tool (MSST0041, MSST0042), suggesting established protocols for successful expression .

When designing experiments involving HAVCR1 expression modulation, it's crucial to verify expression changes at both mRNA and protein levels. For mRNA quantification, qPCR can be performed using specific primers (Forward: GACAATGTTTCAACGA; Reverse: ACTGAACCTGACCGTACATGGAGGAACAAA) with normalization to housekeeping genes like GAPDH . Protein expression should be confirmed using Western blotting or ELISA.

What is known about HAVCR1's role in the IL-6/STAT-3/HIF-1A pathway in cancer cells?

HAVCR1 has been identified as an activator of the IL-6/STAT-3/HIF-1A axis in clear cell renal carcinoma (ccRCC)-derived cell lines, with significant implications for tumor growth and angiogenesis. Mechanistically, this activation depends on HAVCR1 shedding, suggesting that the cleaved form of the protein plays a critical role in signaling pathway activation .

Microarray analysis of ccRCC-derived 769-P cells with manipulated HAVCR1 levels (both upregulated and silenced) has revealed relevant HAVCR1-related targets, providing insights into the downstream effectors of HAVCR1 signaling . Significantly, clinical studies with a cohort of 98 ccRCC patients with 100-month follow-up demonstrated that phosphorylated STAT-3 at serine 727 (pSTAT-3 S727) represents an independent prognostic factor for these patients .

Researchers investigating this pathway should consider dual approaches: in vitro studies using cell lines with modulated HAVCR1 expression and analysis of clinical samples to correlate expression patterns with patient outcomes. Phosphorylation-specific antibodies for STAT-3 are essential tools for these investigations.

How does HAVCR1 affect cellular junction integrity in epithelial cells?

HAVCR1 has been implicated in the regulation of cellular junction integrity, particularly in the context of cancer progression. Studies in prostate cancer cells have demonstrated that HAVCR1 initiates cancer progression via Hepatocyte Growth Factor (HGF)-induced changes in junctional integrity .

When studying HAVCR1's effects on junction integrity, researchers should examine key junction proteins including ZO-1, ZO-2, claudin-1 (CLDN1), occludin (OCLN), α-catenin, and β-catenin. These can be assessed at the mRNA level using PCR with specific primers as detailed in the research protocols . At the protein level, immunofluorescence visualization allows for assessment of protein localization and junction integrity.

Functional assays to measure junction integrity include transepithelial resistance (TER) and paracellular permeability (PCP) assays. For TER measurements, cells should be seeded into 0.4 μm pore inserts at 5×10³ cells per insert, allowed to grow to confluence, and resistance measured using an epithelial volt/ohm meter. Results should be converted to Ω·cm² by multiplying the measured resistance by the surface area of the insert . For PCP assays, both TRITC-dextran (40 kDa) and FITC-dextran (10 kDa) can be used to assess size-selective barrier function .

What controls are essential when studying recombinant HAVCR1 in HEK expression systems?

When studying recombinant HAVCR1 in HEK expression systems, several controls are essential to ensure reliable and interpretable results. First, empty vector controls are critical for distinguishing the effects of HAVCR1 expression from those of the expression system itself. These controls involve transfecting cells with the expression vector lacking the HAVCR1 gene.

Second, wild-type (non-transfected) HEK cells serve as baseline controls for comparing cellular phenotypes and biochemical parameters. Additionally, researchers should include functional mutants of HAVCR1 targeting key domains (e.g., the phosphatidylserine-binding domain or the cytoplasmic signaling domain) to delineate structure-function relationships.

For protein interaction studies, researchers should employ both positive controls (known interacting partners) and negative controls (proteins not expected to interact with HAVCR1). When assessing HAVCR1 shedding—a critical aspect of its function in activating the IL-6/STAT-3/HIF-1A pathway—matrix metalloproteinase inhibitors can serve as functional controls .

How can researchers effectively measure HAVCR1 shedding in experimental models?

HAVCR1 shedding is a crucial aspect of its function, particularly in the activation of the IL-6/STAT-3/HIF-1A pathway in cancer cells . To effectively measure HAVCR1 shedding, researchers should employ a combination of approaches targeting both the released extracellular domain and the remaining membrane-bound portion.

For detecting the shed extracellular domain in cell culture supernatants, enzyme-linked immunosorbent assay (ELISA) represents a quantitative approach. Commercial ELISA kits for human HAVCR1 are available (e.g., RAB0743) and can be used according to manufacturer's instructions. Western blotting of concentrated culture supernatants using antibodies targeting the extracellular domain provides an alternative approach for visualizing the shed portion.

To assess the membrane-bound portion remaining after shedding, researchers should analyze cell lysates using Western blotting with antibodies targeting the cytoplasmic domain of HAVCR1. Flow cytometry with antibodies recognizing the extracellular domain can also quantify the reduction in surface expression following shedding-inducing stimuli.

For inhibition studies, matrix metalloproteinase inhibitors (given HAVCR1's dependence on shedding for activating downstream pathways) can be used to confirm the specificity of shedding-dependent effects .

What cell-based assays are most informative for studying HAVCR1 function in cancer research?

When investigating HAVCR1's role in cancer research, several cell-based assays provide critical insights into its functional effects. These assays should target key cancer-related phenotypes including proliferation, invasion, migration, and cell signaling.

For invasion studies, MatrigelTM-coated transwell assays represent an effective approach. Cells with modulated HAVCR1 expression should be seeded at 5×10⁴ cells per insert in serum-free medium, and cells that invade through the MatrigelTM layer and migrate to the underside of the insert can be quantified using crystal violet staining .

Migration capability can be assessed using both transwell migration assays (without MatrigelTM coating) and the standard wound healing/scratch model. For the latter, cells should be seeded in quadruplicate into 24-well plates at 5×10³ cells per well, a manual scratch performed, and images taken at regular intervals to monitor wound closure .

For investigating HAVCR1's effects on cell signaling pathways, particularly the IL-6/STAT-3/HIF-1A axis implicated in clear cell renal carcinoma, phosphorylation-specific Western blotting and reporter gene assays represent informative approaches . Antibody microarray technology has also been successfully employed to identify relevant signaling targets regulated by HAVCR1 .

How should researchers interpret changes in HAVCR1 expression across different cancer types?

Interpreting changes in HAVCR1 expression across different cancer types requires careful consideration of context-specific factors and methodological approaches. The search results indicate that HAVCR1 upregulation has been observed in clear cell renal carcinoma (ccRCC) and prostate cancer, where it appears to promote tumor growth, angiogenesis, and cellular invasion .

When analyzing HAVCR1 expression data, researchers should first consider the detection method used. For mRNA expression, qPCR with specific primers (as detailed in source ) provides quantitative data, but should be normalized to appropriate housekeeping genes like GAPDH. For protein detection, specific antibodies validated for Western blotting, immunohistochemistry, or ELISA should be employed .

The interpretation should consider both the magnitude of expression changes and their correlation with clinical parameters. In ccRCC, HAVCR1-related pathway activation, particularly pSTAT-3 S727 levels, represented an independent prognostic factor for patients . Researchers should also examine downstream targets of HAVCR1 signaling, which may vary across cancer types. Cross-cancer comparisons should acknowledge tissue-specific expression patterns and the potential for different functional roles of HAVCR1 in different cellular contexts.

What approaches can help differentiate between the multiple functions of HAVCR1 in experimental settings?

HAVCR1 exhibits multiple functions including viral receptor activity, immune regulation, and cancer progression. Differentiating between these functions in experimental settings requires strategic approaches focusing on specific domains, interaction partners, and functional readouts.

For dissecting HAVCR1's viral receptor functions versus its signaling roles, researchers can employ domain-specific mutations targeting the phosphatidylserine-binding domain (critical for binding enveloped viruses) or the cytoplasmic signaling domain. Expression of these mutants in HEK cells followed by functional assays for viral entry, signaling pathway activation, and cellular phenotypes can distinguish between these functions.

Co-immunoprecipitation studies coupled with mass spectrometry can identify context-specific interaction partners of HAVCR1, providing insights into its differential functions across cellular contexts. For distinguishing between HAVCR1's roles in junction regulation versus inflammatory signaling, researchers should employ both junction integrity assays (TER, PCP) and inflammatory cytokine measurements in parallel .

Inhibitor studies targeting specific downstream pathways (e.g., STAT3 inhibitors to block the IL-6/STAT-3/HIF-1A axis) can help determine which HAVCR1 functions depend on particular signaling cascades . Time-course studies are particularly valuable, as they can reveal the temporal sequence of events following HAVCR1 activation, distinguishing primary from secondary effects.

How can researchers validate HAVCR1-related findings from cell culture models in clinical samples?

Validating HAVCR1-related findings from cell culture models in clinical samples represents a critical step in establishing physiological relevance. This translational approach requires careful selection of clinical materials and appropriate analytical techniques.

For protein expression analysis in tissues, immunohistochemical staining using validated antibodies against HAVCR1 and its downstream targets (e.g., pSTAT-3 S727) allows visualization of expression patterns and subcellular localization . Tissue microarrays can facilitate higher-throughput analysis across multiple patient samples. Scoring of staining intensity and localization should be performed blindly by at least two independent observers to ensure reliability .

For liquid biopsies, ELISA kits specifically designed for human HAVCR1 (e.g., RAB0743) enable quantitative measurement in serum or plasma samples . These analyses should be correlated with clinical parameters including disease stage, treatment response, and patient outcomes to establish clinical relevance.

RNA expression analysis in clinical samples can be performed using qPCR with specific primers (as detailed in source ) or RNA sequencing. These analyses benefit from comparison with normal adjacent tissue as an internal control. Multi-parameter analysis correlating HAVCR1 expression with levels of junction proteins (ZO-1, claudin-1) or signaling molecules (pSTAT-3) can provide insights into mechanism conservation between cell models and human samples .

What are common challenges in studying HAVCR1 in HEK expression systems and how can they be addressed?

Studying HAVCR1 in HEK expression systems presents several challenges that require specific optimization strategies. One common challenge is achieving consistent expression levels across experiments. This can be addressed by establishing stable cell lines using selection markers and validating expression levels by Western blotting and qPCR before each experiment.

Another challenge is the potential toxicity of HAVCR1 overexpression, which may affect cell viability and confound experimental results. Researchers should use inducible expression systems (e.g., Tet-On) to control expression timing and level. Additionally, the shed form of HAVCR1 may have autocrine or paracrine effects that complicate the interpretation of results. Researchers can address this by using specific metalloproteinase inhibitors to prevent shedding or by frequent media changes to remove shed protein .

Post-translational modifications of HAVCR1 may vary between HEK cells and the physiological context, potentially affecting protein function. Mass spectrometry analysis of the recombinant protein can identify and characterize these modifications. When studying HAVCR1's viral receptor functions, the presence of endogenous receptors in HEK cells may confound results. Using CRISPR/Cas9 to knockout endogenous receptors can create cleaner systems for studying the specific functions of recombinant HAVCR1.

How can researchers optimize PCR and qPCR protocols for HAVCR1 expression analysis?

Optimizing PCR and qPCR protocols for HAVCR1 expression analysis requires attention to primer design, reaction conditions, and appropriate controls. For standard PCR, researchers can use the following primers for HAVCR1: Forward (5'-CAACAACAAGTGTTCCAGTG-3') and Reverse (5'-GCATTTTGCAAAGCTTTAAT-3'), which yield a 436 bp product. For optimal results, use 30 amplification cycles .

For qPCR, higher specificity primers should be employed: Forward (5'-GACAATGTTTCAACGA-3') and Reverse (5'-ACTGAACCTGACCGTACATGGAGGAACAAA-3'), yielding a 99 bp product . These primers should be diluted appropriately before use (forward primers 1:10 and reverse primers 1:100) and stored at 4°C for temporary use.

GAPDH serves as an effective housekeeping gene for normalization: Forward (5'-CTGAGTACGTCGTGGAGTC-3') and Reverse (5'-ACTGAACCTGACCGTACACAGAGATGATGACCCTTTTG-3') . All qPCR reactions should be performed in triplicate to ensure technical reliability. For analyzing results, the ∆∆CT method normalized to GAPDH provides relative quantification of HAVCR1 expression.

When comparing HAVCR1 expression across different experimental conditions or cell types, standard curves using serial dilutions of a positive control sample can improve quantification accuracy. For detecting specific HAVCR1 isoforms, primer design should target unique exon junctions.

What are the best approaches for studying HAVCR1 protein interactions in research settings?

Studying HAVCR1 protein interactions requires a combination of biochemical, cellular, and biophysical approaches to comprehensively map its interactome. Co-immunoprecipitation (co-IP) represents a foundational technique for identifying protein-protein interactions. For co-IP studies, researchers should use antibodies specific to different domains of HAVCR1 to capture different interaction complexes. Both endogenous co-IP (in cells naturally expressing HAVCR1) and overexpression systems with tagged versions (e.g., FLAG, HA, or GFP-tagged HAVCR1) can provide complementary insights.

For identifying novel interaction partners, mass spectrometry analysis of immunoprecipitated complexes offers an unbiased approach. The KinexusTM Antibody Microarray mentioned in the research methodology can also reveal interactions with signaling proteins . Proximity ligation assay (PLA) provides a sensitive method for visualizing protein interactions in situ with subcellular resolution, which is particularly valuable for studying dynamic interactions.

For confirming direct interactions and determining binding affinities, recombinant proteins expressed in HEK cells (such as those referenced in search result : MSST0041, MSST0042) can be used in biophysical assays including surface plasmon resonance or isothermal titration calorimetry. Domain mapping using truncated versions of HAVCR1 helps identify specific interaction interfaces.

When studying HAVCR1's interactions with viral proteins, viral overlay assays using purified viral proteins can determine direct binding. For interactions dependent on HAVCR1 shedding, comparing full-length versus the shed extracellular domain can reveal differential interaction partners and mechanisms.