HDAC4 Monoclonal Antibody

What are the common applications for HDAC4 monoclonal antibodies in research settings?

HDAC4 monoclonal antibodies are extensively utilized in multiple experimental techniques including:

• Western blotting (WB)

• Immunoprecipitation (IP)

• Immunofluorescence (IF)

• Immunohistochemistry (IHC)

• Enzyme-linked immunosorbent assay (ELISA)

• Flow cytometry

Many commercial HDAC4 antibodies have been validated for specific applications. For example, the mouse monoclonal HDAC4 antibody (A-4) has been confirmed for WB, IP, IF, IHC, and ELISA applications with human, mouse, and rat samples . When selecting an antibody, verify its validation status for your specific application. Different clones may perform better in certain techniques - for instance, clone 7B2 shows strong reactivity in indirect ELISA and WB applications , while clone 7E2E6 has been primarily tested in indirect ELISA .

What is the expected molecular weight for HDAC4 detection in Western blot experiments?

While the predicted molecular weight of HDAC4 is approximately 119 kDa based on amino acid sequence, it typically appears at 140-150 kDa in SDS-PAGE. This discrepancy is attributed to post-translational modifications, particularly extensive phosphorylation and SUMOylation .

When performing Western blot analysis, prepare to visualize bands at approximately 140 kDa rather than at the calculated weight. For example, in Western blots using Human/Mouse/Rat HDAC4 antibody (AF6205), a specific band was detected at approximately 140 kDa in lysates from multiple cell lines including HeLa, Jurkat, NIH-3T3, and NRK . This apparent molecular weight difference is an important validation characteristic for HDAC4 detection.

What species reactivity can be expected with HDAC4 monoclonal antibodies?

The species reactivity varies between different HDAC4 monoclonal antibody clones:

When working with non-human samples, it's essential to choose antibodies that have been validated for cross-reactivity. For instance, antibody clone HDAC-144 has been cited in 11 publications and validated for reactivity with human, mouse, and rat samples . Always check the manufacturer's validation data and any relevant publications before selecting an antibody for non-human experimental systems.

How should HDAC4 antibody samples be stored and handled for optimal performance?

For long-term storage of HDAC4 monoclonal antibodies:

• Store at -20°C for up to one year

• For frequent use, store at 4°C for up to one month

• Avoid repeated freeze-thaw cycles as this can diminish antibody performance

Most commercial HDAC4 antibodies are supplied in buffers containing stabilizers:

• Typical formulation includes buffer (e.g., 0.1M Tris-Glycine, pH 7.4, 150 mM NaCl)

• Often contains preservatives (0.2% sodium azide)

• May include protein stabilizers and glycerol (typically 50%)

When working with the antibody, keep it on ice during experiments, avoid unnecessary exposure to room temperature, and return to appropriate storage conditions immediately after use. Following these handling practices will help maintain antibody performance and extend its usable life in the laboratory.

What are the optimal conditions for detecting HDAC4 in Western blot applications?

For optimal HDAC4 detection by Western blot, consider these methodological recommendations:

Sample preparation:

• Use fresh cell/tissue lysates when possible

• Include phosphatase inhibitors in lysis buffer to preserve phosphorylation status

• Load 40 μg of protein per lane for adequate detection

Electrophoresis conditions:

• Use 10% SDS-PAGE for optimal separation

• Run at 120V for standard gels

Transfer settings:

• Transfer to PVDF membrane (recommended over nitrocellulose for HDAC4)

• Transfer at 100V for 120 minutes for complete transfer of large proteins

Antibody dilutions and detection:

• Primary antibody: Typically 1:1000-1:2000 dilution (e.g., 1 μg/mL for AF6205)

• Secondary antibody: HRP-conjugated antibody matching the host species of primary

• Use enhanced chemiluminescence for visualization

For confirmation of specificity, include positive control lysates such as HeLa, Jurkat (human), NIH-3T3 (mouse), or NRK (rat) cell lines that are known to express HDAC4 . Consider performing experiments under reducing conditions for optimal results.

How can HDAC4 antibodies be used to study protein-protein interactions?

HDAC4 interacts with several transcription factors and co-repressors, particularly MEF2 family proteins. To study these interactions:

Co-immunoprecipitation protocol:

• Prepare cell lysates in mild lysis buffer (e.g., Buffer B–0.15 M KCl)

• Pre-clear lysates with appropriate control beads

• Incubate with anti-HDAC4 antibody (e.g., Flag-tagged HDAC4 can be immunoprecipitated with anti-Flag M2-agarose beads)

• Wash immunocomplexes four times with buffer

• Elute bound proteins with specific peptide or low pH buffer (e.g., 0.1 M glycine-HCl, pH 2.5)

• Analyze by SDS-PAGE and Western blotting with antibodies against potential interacting proteins

For examining HDAC4-MEF2C interactions specifically, co-transfect expression plasmids for both proteins, then perform immunoprecipitation with anti-HDAC4 antibody and probe Western blots with anti-MEF2C antibody . Through this approach, researchers have demonstrated that HDAC4 physically interacts with MEF2C through its N-terminal domain, which is crucial for understanding how HDAC4 regulates transcription factors.

What controls and validation steps should be included when using HDAC4 antibodies?

Essential controls for HDAC4 antibody experiments:

Positive controls:

• Cell lines with known HDAC4 expression (HeLa, Jurkat, NIH-3T3, MCF-7)

• Recombinant HDAC4 protein

Negative controls:

• HDAC4 knockdown/knockout samples (using siRNA or CRISPR/Cas9)

• Competitive blocking with immunizing peptide

• Isotype control antibody

Validation methods:

• Multiple antibody approach: Use antibodies targeting different epitopes of HDAC4

• Genetic validation: Compare signals between wild-type and HDAC4-deficient samples

• Signal specificity verification: Observe absence of cross-reactivity with other HDAC family members

• Cross-technique validation: Confirm findings using complementary methods (e.g., IF and WB)

For RNA interference validation, researchers have successfully used multiple shRNA constructs targeting different regions of HDAC4 (examples: GCAGATCCAGCGGCAGATACT; GCAGTTGTCCCGACAGCATGA; GCATGAGGCACAGTTGCATGA) . These can be delivered via lentiviral vectors for efficient knockdown. Following transfection and selection, validate knockdown efficiency by both qRT-PCR and Western blotting before proceeding with functional studies.

How can researchers optimize immunofluorescence protocols for studying HDAC4 subcellular localization?

HDAC4 exhibits dynamic subcellular localization between nucleus and cytoplasm, which is important for its function. To optimize immunofluorescence:

Sample preparation:

• For cultured cells: Fix with 4% paraformaldehyde (10 minutes at room temperature)

• Permeabilize with 0.1% Triton X-100 (5 minutes)

• Block with 1-5% BSA or normal serum

Antibody selection and dilution:

• Use antibodies validated specifically for IF applications (e.g., HDAC4 Antibody HDAC-144)

• Typical working dilution: 5-10 μg/mL for polyclonal antibodies

• Incubate 1-3 hours at room temperature or overnight at 4°C

Visualization strategies:

• Use fluorophore-conjugated secondary antibodies matching primary antibody host

• Counterstain nuclei with DAPI to assess nuclear vs. cytoplasmic localization

• For colocalization studies, select compatible fluorophores (e.g., NorthernLights™ 557-conjugated secondary antibody)

Analysis considerations:

• HDAC4 shuttling can be stimulus-dependent; consider time-course experiments

• Phosphorylation status affects localization; compare with phospho-specific antibodies

• Perform Z-stack imaging to accurately determine nuclear vs. cytoplasmic distribution

In MCF-7 human breast cancer cells, HDAC4 was successfully visualized in the cytoplasm using IF with a polyclonal HDAC4 antibody at 10 μg/mL for 3 hours at room temperature, followed by NorthernLights™ 557-conjugated secondary antibody .

What are the considerations when using HDAC4 antibodies for studying its role in developmental processes?

HDAC4 plays critical roles in development, particularly in skeletal and neuronal tissues. When studying developmental processes:

Tissue-specific considerations:

• Neural crest-derived tissues: HDAC4 regulates proliferation of neural crest cell-derived osteoblasts

• Craniofacial development: HDAC4 knockout affects frontal bone formation

• Muscle development: HDAC4 interacts with MEF2 transcription factors

Experimental approaches:

• Conditional knockouts: Use Cre-mediated recombination to disrupt HDAC4 in specific tissues

• Developmental timing: Analyze HDAC4 expression at different developmental stages

• Cell proliferation studies: Assess how HDAC4 affects cell cycle progression through analysis of markers like PCNA, CDK1, and CDKN1A

Antibody applications in developmental studies:

• Immunohistochemistry for tissue localization (validated for human testis with antibody MAB6205 at 5 μg/mL)

• Western blotting to compare expression levels between developmental stages

• Co-IP to identify stage-specific interaction partners

Research has shown that HDAC4 deficiency in cranial neural crest cell-derived osteoblasts results in decreased frontal bone formation, associated with reduced proliferative activity and dysregulation of cell cycle-related genes . These findings highlight the importance of HDAC4 in regulating cell proliferation during craniofacial skeletal development.

How can researchers differentiate between HDAC4 and other HDAC family members in experimental systems?

Distinguishing between HDAC family members is crucial due to their structural similarities and potentially overlapping functions:

Antibody selection strategies:

• Choose antibodies raised against unique regions (particularly N-terminal domains)

• Verify specificity against recombinant proteins of multiple HDAC family members

• Test for cross-reactivity in systems overexpressing specific HDACs

Experimental approaches for differentiation:

• Molecular weight discrimination: HDAC4 (140 kDa) vs HDAC1-3 (55-65 kDa)

• Subcellular localization: Class IIa HDACs (including HDAC4) shuttle between nucleus and cytoplasm

• Functional assays: Use class-specific HDAC inhibitors to distinguish activities

• Domain-specific interactions: HDAC4 uniquely interacts with MEF2 transcription factors

Genetic approaches:

• Use siRNA/shRNA targeting unique regions of HDAC4 mRNA

• Complement antibody studies with RT-qPCR using isoform-specific primers

• CRISPR/Cas9 knockout of specific HDAC family members

HDAC4 belongs to the class IIa subfamily and contains unique structural features compared to class I HDACs (HDAC1-3), including an extended N-terminal domain that mediates interactions with transcription factors and co-repressors . This distinct domain architecture can be exploited for selective detection and functional analysis.

Table 1: Comparison of Commercial HDAC4 Monoclonal Antibodies

Table 2: Molecular Characteristics of HDAC4

Table 3: HDAC4 Interaction Partners and Functions