HDGFRP3 Antibody

What is HDGFRP3 and why is it important in research?

HDGFRP3 (Hepatoma-Derived Growth Factor-Related Protein 3) is a nuclear protein belonging to the HDGF protein family. It has a canonical length of 203 amino acid residues and a molecular mass of 22.6 kDa, though it typically appears at approximately 28-30 kDa on Western blots due to post-translational modifications . It is primarily expressed in the testis, heart, spinal cord, and brain, with notable roles in:

• Chromatin remodeling and neuronal development

• DNA double-strand break (DSB) repair through interaction with 53BP1

• Angiogenesis as an endothelial growth factor

• Transcriptional regulation via its PWWP domain (a potential histone methylation reader)

Research interest in HDGFRP3 has increased due to its involvement in DNA repair pathways and potential implications in cancer research, particularly its relationship with PARP inhibitor resistance in BRCA1-deficient cells .

What applications are HDGFRP3 antibodies validated for?

HDGFRP3 antibodies have been validated for multiple applications with varying success:

When selecting an antibody, researchers should review the validation data for their specific application and target species .

How specific is HDGFRP3 protein expression across tissues?

HDGFRP3 shows tissue-specific expression patterns:

• High expression: Testis, heart, spinal cord, and brain

• Moderate expression: Endothelial cells of blood vessels

• Specialized function: In neurons, where it plays a role in neurite outgrowth and neuronal development

For IHC studies, positive staining has been documented in:

• Human prostate cancer tissue

• Rat spinal cord

• Human uterine cancer

This tissue expression profile should be considered when selecting positive control tissues for antibody validation .

How can I verify the specificity of my HDGFRP3 antibody beyond manufacturer claims?

Following tiered validation approaches , advanced verification should include:

Level 3 Validation Protocol (for newly generated or poorly characterized antibodies):

• Pre-IHC verification: Perform Western blot analysis using cell/tissue lysates (not just recombinant protein) to confirm single-band detection at the expected molecular weight (approximately 28-30 kDa)

• Knockout/knockdown controls: Generate HDGFRP3 knockout or knockdown cell lines using CRISPR-Cas9 or siRNA methodologies. Published sequences include:

  • HDGFRP3_sgRNA1: GCGGCCCCGCGAGTACAAAG

  • HDGFRP3_sgRNA2: GAAGGGCTACCCGCACTGGC

  • HDGFRP3_siRNA1: GAUUGUGGGAAAUAGAAAA

  • HDGFRP3_siRNA2: CUGCAUUUCUAGGUCCCAA

• Comparative antibody testing: Use multiple antibodies targeting different epitopes of HDGFRP3 (e.g., AA 15-44, AA 90-203) to confirm consistent staining patterns

• Orthogonal method confirmation: Combine antibody detection with mRNA expression data or in situ hybridization

• Positive and negative tissue panels: Test across tissues with known high expression (brain, testis) and low/no expression

This multilayered approach ensures antibody specificity beyond what manufacturer datasheets typically demonstrate.

What are the considerations for using HDGFRP3 antibodies in studying DNA repair mechanisms?

When investigating HDGFRP3's role in DNA double-strand break repair:

• Co-localization studies: HDGFRP3 associates with 53BP1 in chromatin fractions; therefore, co-immunoprecipitation and proximity ligation assay (PLA) techniques are recommended

• Post-irradiation dynamics: The interaction of HDGFRP3 with methylated H4K20 decreases after ionizing radiation, while 53BP1-methylated H4K20 interaction increases—this dynamic should be considered in experimental timelines

• Recommended control markers: Include γH2AX staining as a DSB marker when performing co-localization experiments

• Functional assays: Incorporate random plasmid integration assays and PARP inhibitor resistance assays to evaluate functional implications of HDGFRP3 knockdown/knockout

• Phosphorylation status: Consider post-translational modifications that may affect antibody recognition, particularly after DNA damage induction

For combined immunofluorescence and PLA experiments, researchers should carefully select antibody hosts to avoid cross-reactivity (e.g., anti-rat 53BP1 with anti-rabbit HDGFRP3 and anti-mouse 53BP1) .

Why might I observe discrepancies between predicted (22.6 kDa) and observed (28-30 kDa) molecular weights of HDGFRP3?

This common discrepancy occurs due to several factors:

For conclusive identification, consider:

• Mass spectrometry analysis of immunoprecipitated protein

• Comparison with knockout/knockdown samples

• Dephosphorylation experiments to observe mobility shifts

What are the optimal conditions for HDGFRP3 antibody use in immunohistochemistry?

Based on published validations, follow these methodological guidelines:

For IHC-P (paraffin-embedded tissues):

• Antigen retrieval: Use TE buffer pH 9.0 as the primary method; citrate buffer pH 6.0 as an alternative

• Antibody dilutions:

  • Primary antibody: 1:50-1:200 for most HDGFRP3 polyclonal antibodies

  • Detection systems: HRP or fluorophore-conjugated secondary antibodies following manufacturer protocols

• Positive control tissues:

  • Rat spinal cord

  • Human prostate cancer tissue

  • Human uterine cancer tissue

• Blocking conditions:

  • 3-5% normal serum (matched to secondary antibody host)

  • Alternative: 3% nonfat dry milk in TBST

• Visualization method:

  • DAB chromogen for brightfield

  • Fluorophore-conjugated secondaries (FITC, Alexa Fluor) for co-localization studies

Include both positive and negative controls in each experiment, with isotype-matched control antibodies for proper background assessment .

How should I optimize HDGFRP3 antibody conditions for Western blot detection?

For optimal Western blot results with HDGFRP3 antibodies:

• Sample preparation:

  • Tissue lysis in RIPA buffer

  • Inclusion of phosphatase inhibitors to preserve modification states

  • Load 25μg protein per lane for standard detection

• Gel conditions:

  • 10-12% SDS-PAGE for optimal resolution around 28-30 kDa

  • Include positive control lysates (brain tissue or testis recommended)

• Transfer and blocking:

  • PVDF membrane recommended

  • Block with 3-5% nonfat dry milk in TBST

• Antibody incubation:

  • Primary: 1:500-1:2000 dilution (overnight at 4°C)

  • Secondary: 1:10000 HRP-conjugated (1 hour at room temperature)

• Detection system:

  • ECL-based detection for standard applications

  • Exposure time optimization: start with 10s and adjust as needed

• Troubleshooting guidance:

  • Multiple bands: Consider testing with knockout/knockdown controls

  • Weak signal: Extended exposure, increased antibody concentration, or enhanced chemiluminescence

  • High background: More stringent washing, lower antibody concentration

What experimental design considerations are needed for HDGFRP3 knockdown or knockout studies?

When designing HDGFRP3 genetic manipulation experiments:

• CRISPR-Cas9 knockout strategy:

  • Target early exons for complete knockout

  • Use validated sgRNA sequences (see 2.1)

  • Include mCherry or other selection markers for sorting

  • Clone and sequence the targeted region to confirm frameshift mutations

• siRNA knockdown approach:

  • Use at least two independent siRNA sequences to control for off-target effects

  • Optimal transfection with Lipofectamine 3000 or equivalent

  • Confirm knockdown efficiency by Western blot 48-72 hours post-transfection

• Validation methods:

  • Western blotting with HDGFRP3 antibody

  • RT-qPCR for mRNA expression

  • Functional assays relevant to expected phenotypes (e.g., DNA repair efficiency, cell proliferation)

• Controls to include:

  • Wild-type parental cells

  • Cells treated with non-targeting sgRNA/siRNA

  • Rescue experiments with HDGFRP3 cDNA resistant to knockdown

• Phenotypic analysis:

  • DNA damage response (53BP1/γH2AX foci formation)

  • Cell proliferation and survival assays

  • PARP inhibitor sensitivity testing in relevant cell types

How can I perform co-localization studies of HDGFRP3 with DNA damage response proteins?

For investigating HDGFRP3's role in the DNA damage response:

• Combined PLA and immunofluorescence protocol:

  • Prepare cells on slides and induce DNA damage (e.g., ionizing radiation, neocarzinostatin)

  • Incubate with antibody combinations:

    • Anti-rat 53BP1 antibody

    • Anti-rabbit HDGFRP3 antibody

    • Anti-mouse 53BP1 antibody (for PLA)

  • After washing, incubate with appropriate secondary antibody (chicken anti-rat-Alexa Fluor-488) concurrently with PLA probes

  • For γH2AX visualization, use direct conjugation (Alexa-Fluor 488 mouse γH2AX)

• Image acquisition parameters:

  • Confocal microscopy with appropriate filter sets

  • Z-stack acquisition for complete nuclear analysis

  • Time-course imaging after damage induction (0, 1, 6, 24 hours)

• Quantification approaches:

  • Foci counting and co-localization analysis

  • Intensity correlation analysis

  • PLA signal quantification in relation to damage markers

This approach allows simultaneous visualization of protein interactions and localization at DNA damage sites.