HMOX1 Human

What is HMOX1 and what is its primary function in human cells?

HMOX1, also known as HO-1 or HSP32, is a stress-induced enzyme that catalyzes the oxidative cleavage of heme at the alpha-methene bridge carbon. This reaction produces carbon monoxide (CO), biliverdin IXalpha, while releasing the central heme iron chelate as ferrous iron . HMOX1 is considered one of the most sensitive and reliable indicators of cellular oxidative stress .

The primary function of HMOX1 extends beyond mere heme degradation. It affords protection against programmed cell death, with this cytoprotective effect relying on its ability to catabolize free heme and prevent it from sensitizing cells to undergo apoptosis . Additionally, HMOX1 plays a crucial role in cellular antioxidant defense, as demonstrated by increased vulnerability to oxidative challenges in HMOX1-deficient cells .

How is HMOX1 expression regulated in human cells?

HMOX1 expression is tightly regulated by various stress stimuli. Under normal conditions, HMOX1 expression is difficult to detect in most tissues, but it is strongly upregulated during cellular stress . The enzyme serves as an adaptive mechanism to protect cells from oxidative damage during stress conditions.

Several inducers can increase HMOX1 protein levels in certain cell lines. For example, cobalt chloride (CoCl₂) has been shown to induce HMOX1 expression in HeLa cells . Additionally, stimuli such as hemin, hydrogen peroxide, paraquat, or cadmium chloride can trigger HMOX1 upregulation as part of the cellular stress response .

Where is HMOX1 localized within human cells?

HMOX1 is primarily localized to the endoplasmic reticulum membrane . This localization is critical for its function in heme catabolism and cellular protection. The 33 kDa protein (predicted molecular weight) can also appear as truncated forms of 28 kDa in certain tissues, such as spleen tissue .

Post-translational modifications, particularly phosphorylation, can affect HMOX1 localization and function, adding another layer of regulation to this important enzyme .

What is the relationship between HMOX1 and HIF-1α in hypoxic conditions?

In wild-type mice, ischemia-induced expression of HMOX1 in skeletal muscle occurs before the stabilization of HIF-1α. Furthermore, HIF-1α stabilization and glucose utilization were impaired in HMOX1-deficient mice compared to wild-type mice under ischemic conditions . These observations suggest that HMOX1 is required for proper HIF-1α stabilization during hypoxia.

Mechanistic studies have shown that carbon monoxide, one of the products of HMOX1 activity, can stabilize HIF-1α in HMOX1-deficient fibroblasts in response to hypoxia . This indicates a feedback loop where HMOX1 enzymatic products contribute to HIF-1α regulation, which in turn can further regulate HMOX1 expression.

How does HMOX1 protect against ischemia-mediated injury?

HMOX1 protects against ischemia-mediated injury through multiple mechanisms. Studies using HMOX1-deficient (HMOX1⁻/⁻) mice demonstrated severely impaired blood flow recovery with tissue necrosis and autoamputation following unilateral hindlimb ischemia .

The protective effects of HMOX1 appear to be independent of neovascularization, as autoamputation in HMOX1-deficient mice preceded the return of blood flow, and bone marrow transfer from wild-type mice failed to prevent tissue injury . Instead, HMOX1 protection is linked to cellular energy reprogramming in response to ischemia.

Metabolomics analyses indicated that HMOX1-deficient mice fail to adapt cellular energy reprogramming in response to ischemia. Prolyl-4-hydroxylase inhibition, which stabilizes HIF-1α in HMOX1-deficient models, decreased tissue necrosis and autoamputation, and restored cellular metabolism to that of wild-type mice . This suggests that HMOX1 protection against ischemic injury operates significantly through HIF-1α-dependent metabolic adaptation pathways.

What is the role of HMOX1 in ferroptosis and how does this relate to atherosclerosis?

HMOX1 has been identified as a critical ferroptosis-related gene in atherosclerosis . Ferroptosis is a novel form of programmed iron-dependent cell death, and increasing evidence indicates its involvement in atherosclerosis progression.

Bioinformatic analysis of atherosclerosis datasets (GSE28829 and GSE43292) identified HMOX1 as an essential ferroptosis-related differentially expressed gene (DEG) . The expression of HMOX1 was found to increase significantly as atherosclerosis progressed, suggesting its potential as a diagnostic biomarker.

Experimental validation confirmed that HMOX1 displays a pro-ferroptotic effect on vascular smooth muscle cells (VSMCs) . Additionally, high expression of HMOX1 in atherosclerotic plaques was accompanied by matrix metalloproteinases (MMPs) production and M0 macrophages infiltration, linking HMOX1 to inflammatory processes in atherosclerosis .

Single-gene analysis of HMOX1 in atherosclerosis revealed that genes differentially expressed in HMOX1-high vs. HMOX1-low samples were enriched in pathways related to:

• Muscle system processes

• Cellular response to oxidative stress

• Reactive oxygen species (ROS)

• Regulation of vascular smooth muscle cell proliferation

• Lipid and cholesterol metabolism

• Fluid shear stress and atherosclerosis

• PPAR signaling pathway

• TNF signaling pathway

These findings suggest that HMOX1 connects ferroptosis with multiple pathophysiological processes in atherosclerotic progression, including immunity and inflammation.

What experimental considerations should be taken when studying HMOX1 expression?

When studying HMOX1 expression, researchers should consider several important factors:

• Expression specificity: HMOX1 exhibits expression specificity across different tissues and conditions. Researchers should confirm the expression of HMOX1 in their specific sample beforehand .

• Positive controls: When uncertain about expression levels, it is advisable to use appropriate positive controls. Recommended positive controls include:

  • A549 whole cell lysate

  • NIH-3T3 whole-cell lysate

  • Mouse and rat spleen tissue lysate

• Induction conditions: For in vitro studies, stimulation or induction can increase HMOX1 protein levels in certain cell lines. For example, CoCl₂ induction in HeLa cells can enhance HMOX1 expression .

• Molecular weight considerations: While the predicted molecular weight of HMOX1 is 33 kDa, truncated forms of 28 kDa can be observed in some tissues (e.g., spleen tissue), and sometimes larger unknown bands may also be detected .

What are effective methods for HMOX1 detection in human samples?

Several methods can be employed for efficient detection of HMOX1 in human samples:

• Western Blotting (WB):

  • Recommended antibody: Anti-Heme Oxygenase 1 antibody [EPR1390Y] (ab68477)

  • Sample loading: 10 μg of whole cell lysate is typically sufficient

  • Expected band size: 33 kDa (primary band), with possible 28 kDa truncated forms

• Immunocytochemistry (ICC):

  • Anti-Heme Oxygenase 1 antibody can be used for cellular localization studies

  • Typical visualization: Green fluorescence for HMOX1 with DAPI counterstain for nuclei

• qPCR:

  • Specific primers are available for human HMOX1 (NM_002133)

  • Forward Sequence: CCAGGCAGAGAATGCTGAGTTC

  • Reverse Sequence: AAGACTGGGCTCTCCTTGTTGC

  • PCR conditions: Activation at 50°C for 2 min; pre-soak at 95°C for 10 min; followed by denaturation at 95°C for 15 sec and annealing at 60°C for 1 min

How can researchers effectively model HMOX1 deficiency for functional studies?

To study the functional significance of HMOX1, researchers can model HMOX1 deficiency through several approaches:

When interpreting results from HMOX1-deficient models, researchers should consider potential compensatory mechanisms and the broader physiological context, as HMOX1 deficiency affects multiple cellular processes including energy metabolism, oxidative stress responses, and HIF-1α signaling .

How is HMOX1 involved in cardiovascular disease pathogenesis?

HMOX1 plays complex roles in cardiovascular disease pathogenesis, particularly in atherosclerosis:

• Atherosclerosis progression: HMOX1 has been identified as a key ferroptosis-related gene in atherosclerosis. Its expression increases significantly as atherosclerosis progresses, suggesting potential as a diagnostic biomarker .

• Inflammatory processes: High expression of HMOX1 in atherosclerotic plaques correlates with matrix metalloproteinases (MMPs) production and M0 macrophages infiltration. ssGSEA analysis showed that high HMOX1 expression is related to stronger immune responses and macrophage infiltration in atherosclerotic tissues .

• Vascular smooth muscle cells (VSMCs): Gene ontology analysis revealed that HMOX1-related differentially expressed genes were significantly enriched in pathways involving the regulation of vascular smooth muscle cell proliferation, indicating HMOX1's importance in VSMC biological changes .

• Metabolic pathways: HMOX1 expression in atherosclerotic plaques is associated with differential regulation of lipid metabolism, cholesterol metabolism, and PPAR signaling pathways—all critical processes in cardiovascular disease development .

Research has demonstrated that HMOX1 operates at the intersection of ferroptosis, inflammation, and vascular remodeling processes in cardiovascular disease contexts, making it a potential therapeutic target.

What are the implications of HMOX1 polymorphisms in human disease susceptibility?

While the provided search results don't directly address HMOX1 polymorphisms, the extensive role of HMOX1 in stress response and disease pathways suggests that genetic variations in this gene could significantly impact disease susceptibility. Researchers interested in this area might explore:

• Promoter polymorphisms: The HMOX1 promoter contains a (GT)n repeat polymorphism that affects transcriptional activity. Shorter repeats generally associate with higher transcriptional activity and potentially greater protection against oxidative stress-related diseases.

• SNP analysis: Single nucleotide polymorphisms in the HMOX1 gene may alter protein function or expression levels, potentially affecting susceptibility to conditions involving oxidative stress.

• Disease associations: Correlation studies between HMOX1 genetic variations and incidence/severity of cardiovascular diseases, particularly atherosclerosis, could provide valuable insights into personalized medicine approaches.

What are promising therapeutic approaches targeting HMOX1?

Based on the protective functions of HMOX1 in various disease contexts, several therapeutic approaches could be considered:

• HMOX1 induction: Chemical compounds that induce HMOX1 expression could potentially provide protection against ischemic injury and oxidative stress-related damage. The search results indicate that carbon monoxide, one of the products of HMOX1 activity, stabilizes HIF-1α and could have therapeutic potential .

• Targeted delivery: Developing methods for tissue-specific induction of HMOX1 could provide localized protection while minimizing systemic effects.

• Combination therapies: Since HMOX1 interacts with multiple pathways, including HIF-1α signaling, combining HMOX1 modulators with other therapeutic agents might synergistically enhance beneficial effects.

• Ferroptosis modulation: Given HMOX1's role in ferroptosis and atherosclerosis, targeting this pathway specifically in vascular tissues could represent a novel approach for atherosclerosis treatment .

Research focused on these therapeutic avenues would benefit from careful consideration of HMOX1's dual roles—protective in some contexts but potentially harmful in others, particularly in advanced atherosclerosis where its pro-ferroptotic effects might contribute to disease progression .