HOXD9 Antibody

What is HOXD9 and what biological roles does it play?

HOXD9 is a member of the Hox family of transcription factors that plays crucial roles in embryonic development and cellular differentiation by regulating downstream target genes. It is particularly vital for proper organ and limb formation during development. In joint development, HOXD9 is primarily expressed in articular cartilage, with notably elevated expression in the synovial tissue of arthritic mice compared to normal mice, suggesting a potential role in arthritis pathology. HOXD9 functions as a multifunctional transcriptional regulator with various activation domains, interacting with regulatory elements to modulate gene expression in both developmental processes and disease conditions . Beyond development, HOXD9 has been implicated in cancer progression, particularly in processes related to epithelial-mesenchymal transition (EMT) and metastasis .

What types of HOXD9 antibodies are available for research applications?

Several types of HOXD9 antibodies are available for research, with the most common being monoclonal antibodies such as the HOXD9 Antibody (H-2), which is a mouse monoclonal IgG1 kappa light chain antibody that detects HOXD9 protein from mouse, rat, and human origin. These antibodies are available in both non-conjugated forms and conjugated variants, including agarose, horseradish peroxidase (HRP), phycoerythrin (PE), fluorescein isothiocyanate (FITC), and multiple Alexa Fluor® conjugates . Additionally, rabbit-derived HOXD9 antibodies are also available, such as those offered by Cell Signaling Technology, which show reactivity with human and monkey samples and are recommended for Western Blotting and Immunoprecipitation applications .

What is the molecular weight of HOXD9 protein and how does this affect antibody selection?

The molecular weight of HOXD9 protein is approximately 42 kDa, as reported in antibody specification sheets . This information is critical when selecting and validating antibodies for specific applications. When performing Western blot analysis, researchers should expect to detect a band at approximately 42 kDa when using a verified HOXD9 antibody. Deviation from this expected molecular weight may indicate potential issues with antibody specificity, protein modification, or experimental conditions. For accurate experimental planning, researchers should always confirm the expected molecular weight through preliminary validation experiments and consider potential post-translational modifications that might alter the apparent molecular weight on SDS-PAGE gels.

What are the optimal protocols for using HOXD9 antibodies in Western blotting?

For Western blotting applications using HOXD9 antibodies, the following methodology is recommended: First, prepare protein lysates from your samples of interest and separate proteins using SDS-PAGE. After transferring proteins to a membrane (PVDF or nitrocellulose), block the membrane with appropriate blocking buffer (typically 5% non-fat milk or BSA in TBST). Incubate the membrane with primary HOXD9 antibody at a 1:1000 dilution overnight at 4°C . After washing with TBST, incubate with appropriate HRP-conjugated secondary antibody. For detection, use enhanced chemiluminescence (ECL) reagents and visualize using a digital imaging system. The expected molecular weight for HOXD9 is 42 kDa . To ensure specificity, include positive controls (tissues/cells known to express HOXD9) and negative controls (tissues/cells with low or no HOXD9 expression) in your experiment. Additionally, optimization of antibody concentration may be necessary depending on the expression level of HOXD9 in your samples.

How should researchers optimize immunohistochemistry protocols for HOXD9 detection in tissue samples?

For optimal immunohistochemical (IHC) detection of HOXD9 in tissue samples, researchers should follow this methodological approach: Begin with paraffin-embedded, formalin-fixed tissue sections (5 μm thickness), deparaffinize using xylene, and rehydrate through gradient concentrations of ethanol. Block endogenous peroxidase activity using 0.35% H₂O₂ in PBS buffer. Antigen retrieval is critical and should be performed by heating in a microwave (350 W) using an appropriate retrieval buffer. Block non-specific binding with 1% bovine serum albumin in PBS buffer. Incubate sections with primary HOXD9 antibody at optimized dilution (start with manufacturer's recommendation), followed by incubation with peroxidase-conjugated secondary antibody (typically 1:100 dilution) . For visualization, use 3,3'-diaminobenzidine (1 mg/mL) with hematoxylin counterstaining. For scoring, a system evaluating both staining intensity (0-3) and percentage of positive cells is recommended, where scores ≥2 with at least 50% protein-positive cells indicate high expression, while scores <2 with <50% protein-positive cells indicate low expression . Independent scoring by multiple investigators is advised for reliability.

What are the best practices for immunoprecipitation using HOXD9 antibodies?

For successful immunoprecipitation (IP) of HOXD9 protein, follow these methodological guidelines: Begin by preparing cell or tissue lysates in a non-denaturing lysis buffer containing protease inhibitors. Pre-clear the lysate by incubating with Protein A/G beads for 1 hour at 4°C. For the IP reaction, add HOXD9 antibody at a 1:100 dilution to the pre-cleared lysate and incubate overnight at 4°C with gentle rotation . Add fresh Protein A/G beads and incubate for 2-4 hours at 4°C. Wash the immune complexes at least 4 times with cold lysis buffer to remove non-specific binding. Elute the bound proteins by boiling in SDS sample buffer. Analyze the immunoprecipitated HOXD9 by SDS-PAGE followed by Western blotting using another HOXD9 antibody that recognizes a different epitope for confirmation. Always include a negative control IP with non-specific IgG from the same species as the HOXD9 antibody. For co-immunoprecipitation experiments to identify HOXD9 interaction partners, milder washing conditions may be necessary to preserve protein-protein interactions.

How is HOXD9 expression altered in colorectal cancer and what techniques best demonstrate this?

HOXD9 expression is significantly upregulated in colorectal cancer (CRC) tissues compared to matched healthy tissues, as demonstrated by multiple analytical techniques. High-throughput tissue microarray immunohistochemistry (TMA-IHC) reveals that HOXD9 is markedly overexpressed in CRC tissues but only marginally detectable in healthy colon tissues . Semiquantitative scoring confirms that cancer tissues show higher HOXD9 expression relative to adjacent healthy colon mucosa samples. Statistical analyses have established that elevated HOXD9 levels are significantly associated with advanced American Joint Committee on Cancer (AJCC) stages, poor tumor differentiation, lymph node metastasis, and other serious invasions, correlating with poor prognosis . For researchers investigating HOXD9 in CRC, a multimodal approach is recommended, combining immunohistochemistry with Western blot and qRT-PCR for comprehensive expression analysis. When conducting TMA-IHC studies, researchers should include matched tumor-normal pairs from the same patients and employ standardized scoring systems with multiple independent evaluators to ensure reliable quantification of expression differences.

What is the relationship between HOXD9 and epithelial-mesenchymal transition (EMT) in cancer progression?

HOXD9 plays a significant role in promoting epithelial-mesenchymal transition (EMT) and subsequent metastasis in cancer, particularly in colorectal cancer (CRC). In vitro studies demonstrate that HOXD9 encourages proliferation, movement, and EMT processes in CRC cells . Mechanistically, TGF-β1 has been shown to promote the expression of HOXD9 in a dose-dependent manner, while downregulation of HOXD9 represses TGF-β1-induced EMT . In vivo studies using orthotopic implantation models confirm that HOXD9 promotes the invasion and metastasis of CRC cells. To investigate this relationship, researchers should employ both gain-of-function (overexpression) and loss-of-function (knockdown/knockout) approaches. Recommended methodologies include wound scratch assays to assess cell migration, transwell invasion assays to evaluate invasive capacity, and Western blot or qRT-PCR analysis of EMT markers (E-cadherin, N-cadherin, vimentin, Snail, Slug, etc.) following HOXD9 modulation. Additionally, researchers should consider examining the TGF-β signaling pathway components to elucidate the complete mechanism by which HOXD9 influences EMT.

What methods are most effective for studying HOXD9's role in cancer cell migration and invasion?

For comprehensive investigation of HOXD9's role in cancer cell migration and invasion, researchers should employ a combination of complementary methodologies. The wound scratch assay is effective for assessing cell migration ability: culture transfectant cells in six-well plates until confluent, create a wound using an aseptic tip, treat with 10 μg/mL mitomycin C to inhibit cell proliferation, and document wound closure over 48-72 hours using phase-contrast microscopy . For invasion assessment, the transwell chamber assay is recommended: place cells in the upper chamber with serum-free medium and allow migration toward serum-containing medium in the lower chamber over 24-48 hours . To isolate the specific effects of HOXD9, establish stable overexpression and knockdown cell lines using lentiviral vectors expressing HOXD9/EGFP (e.g., Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin vector) or HOXD9-specific shRNA . For in vivo validation, orthotopic implantation models provide the most physiologically relevant assessment of metastatic potential. Researchers should complement these functional assays with molecular analyses of migration/invasion-related genes using qRT-PCR, Western blotting, and immunofluorescence to elucidate the underlying mechanisms.

How can researchers effectively design HOXD9 knockdown and overexpression experiments?

For effective HOXD9 genetic manipulation experiments, researchers should consider these methodological approaches: For knockdown studies, use RNA interference (RNAi) through short hairpin RNA (shRNA) constructs targeting specific HOXD9 sequences, such as the validated sequence: CCGGCAGCAACTTGACCCAAACATCAAGAGTGTTTGGGTCAAGTTGCTGTTTTTG . Deliver these constructs using lentiviral vectors for stable integration and expression. For overexpression studies, obtain the complete-length HOXD9 gene cDNA from healthy human samples using RT-PCR, followed by subcloning into appropriate mammalian expression vectors such as pENTER-FLAG . Verify all constructs by sequencing before transfection. After establishing stable cell lines, confirm modulation efficiency through Western blot and qRT-PCR. Include appropriate controls: empty vector controls for overexpression and scrambled/non-targeting shRNA for knockdown experiments. For transient expression studies, optimize transfection conditions for each cell line. When analyzing phenotypic effects, assess multiple aspects including proliferation (using EdU incorporation, CCK-8, or colony formation assays), migration/invasion capabilities, and expression of HOXD9 target genes to comprehensively characterize the functional impact of HOXD9 modulation.

What are the key considerations for antibody validation when studying HOXD9 in novel tissue or cell types?

When validating HOXD9 antibodies for novel tissue or cell types, researchers should implement a multi-step validation process: First, conduct Western blot analysis to confirm detection of a single band at the expected molecular weight of 42 kDa . Include positive controls (tissues/cells known to express HOXD9, such as colorectal cancer samples) and negative controls (tissues with low or undetectable HOXD9 expression). Second, perform siRNA/shRNA knockdown of HOXD9 and demonstrate corresponding reduction in antibody signal. Third, compare results across multiple antibodies targeting different HOXD9 epitopes to confirm consistency. Fourth, for immunohistochemistry applications, optimize antigen retrieval methods, antibody concentration, and incubation conditions specifically for the tissue of interest. Fifth, confirm specificity through immunoprecipitation followed by mass spectrometry to identify the pulled-down protein. Additionally, when studying novel samples, evaluate HOXD9 expression at the mRNA level using qRT-PCR to corroborate protein detection results. For tissues with potential cross-reactivity concerns, preabsorption tests with recombinant HOXD9 protein can help confirm antibody specificity. Finally, clearly document all validation steps, including antibody catalog numbers, dilutions, and experimental conditions in research publications to ensure reproducibility.

How should researchers interpret contradictory results when studying HOXD9 across different cancer types?

When faced with contradictory results regarding HOXD9 expression or function across different cancer types, researchers should implement a systematic analytical approach: First, conduct a detailed comparison of methodologies used across studies, including antibody sources, detection techniques, scoring systems, and sample preparation protocols, as these variables can significantly impact results. Second, consider context-specific biology - HOXD9 may have tissue-specific roles, with expression patterns and functions differing between cancer types based on tissue origin and molecular subtype. For example, HOXD9 is differentially expressed in cervical cancer cell lines like HeLa but absent in normal cervical tissue , while it is also upregulated in colorectal cancer tissues compared to matched healthy samples . Third, evaluate genetic and epigenetic regulation of HOXD9 across cancer types, as promoter methylation or microRNA regulation may vary. Fourth, analyze HOXD9 in the context of broader signaling networks specific to each cancer type - its interaction with TGF-β1 in colorectal cancer may differ in other cancers. To resolve contradictions, design comparative studies using standardized methodologies across multiple cancer types within the same experimental framework, and consider comprehensive multi-omics approaches integrating transcriptomic, proteomic, and functional data to elucidate cancer-specific mechanisms.

What controls should be included when performing cell cycle analysis after HOXD9 modulation?

When conducting cell cycle analysis following HOXD9 manipulation, researchers should implement a comprehensive control strategy to ensure reliable and interpretable results. First, include proper experimental controls: HOXD9 shRNA-treated cells should be compared with scramble shRNA controls processed identically, while HOXD9 overexpression should be compared with empty vector controls . Second, include technical controls for flow cytometry: unstained cells for autofluorescence baseline, single-color controls for compensation, and propidium iodide-only samples without RNase treatment to distinguish RNA from DNA staining. Third, perform time-course analyses at multiple timepoints (24, 48, and 72 hours post-treatment) to capture dynamic cell cycle changes. Fourth, complement flow cytometry with molecular analysis of cell cycle regulators (cyclins, CDKs, p21, p27) by Western blot or qRT-PCR to correlate cell cycle distribution with regulatory mechanisms. Fifth, include synchronized cell populations as reference controls - serum starvation for G0/G1 arrest or thymidine block for S-phase synchronization. Additionally, validate findings using multiple methodologies, such as EdU incorporation assays to confirm S-phase results. Finally, for mechanistic insights, analyze HOXD9-associated cell cycle target genes through chromatin immunoprecipitation (ChIP) to identify direct regulatory relationships between HOXD9 and cell cycle components.

How do antibody-based detection methods for HOXD9 compare in sensitivity and specificity?

The following table summarizes the comparative analysis of different antibody-based detection methods for HOXD9:

For optimal results, researchers should select methods based on their specific research questions, with Western blotting serving as the initial validation step for antibody specificity before proceeding to other applications. Combining multiple detection methods provides the most comprehensive and reliable assessment of HOXD9 expression and function in experimental systems.

What are the critical steps to ensure reproducibility in HOXD9 expression studies across different laboratories?

To ensure reproducibility in HOXD9 expression studies across different laboratories, researchers must implement standardized protocols addressing several critical factors. First, antibody selection and validation: use well-characterized antibodies with demonstrated specificity for HOXD9, document complete antibody information (manufacturer, catalog number, lot number, dilution), and perform validation using positive and negative controls . Second, sample preparation standardization: establish consistent protocols for tissue processing (fixation time, embedding procedures) and protein extraction. Third, detailed methodology documentation: record complete experimental conditions including antigen retrieval methods for IHC, blocking solutions, incubation times and temperatures, and washing procedures . Fourth, quantification standardization: implement objective scoring systems for IHC with multiple independent evaluators, and use reference standards for Western blot quantification. Fifth, data normalization: select appropriate housekeeping genes or proteins that remain stable under experimental conditions, and verify their stability before use as loading controls. Additionally, researchers should share positive control samples between laboratories when establishing new protocols, participate in inter-laboratory validation studies, and utilize open science practices including pre-registration of studies and sharing of detailed protocols through repositories like protocols.io. Ultimately, transparent reporting of all experimental details in publications is essential for reproducibility.