LDHB Human

What is LDHB and how does it function in human cells?

LDHB (Lactate Dehydrogenase B) is one of the two main isoforms of lactate dehydrogenase that catalyzes the conversion of pyruvate to lactate while simultaneously converting NADH to NAD+ . This enzyme functions as a tetramer and plays a crucial role in cellular energy metabolism. Unlike LDHA, which predominantly favors the conversion of pyruvate to lactate, LDHB can efficiently catalyze the reverse reaction (lactate to pyruvate) under physiological conditions.

The LDHB gene is located at locus ID 3945 in humans and is also known by several synonyms including HEL-S-281, LDH-B, LDH-H, LDHBD, and TRG-5 . In terms of expression patterns, LDHB shows tissue-specific distribution with particularly high expression in human pancreatic β cells, where it helps regulate lactate levels and insulin secretion .

To study LDHB function, researchers typically employ enzyme activity assays that measure the rate of NADH oxidation or NAD+ reduction spectrophotometrically, as well as isotope tracing experiments using 13C-labeled glucose to track metabolic flux through the LDH reaction.

What are the standard methods for detecting and quantifying LDHB expression in human tissue samples?

Several complementary approaches can be used to reliably detect and quantify LDHB expression:

1. Quantitative PCR (qPCR):

• Use validated primer pairs targeting LDHB (Forward: GGACAAGTTGGTATGGCGTGTG, Reverse: AAGCTCCCATGCTGCAGATCCA)

• Follow standardized protocols including: activation at 50°C for 2 min; pre-soak at 95°C for 10 min; denaturation at 95°C for 15 sec; annealing at 60°C for 1 min; followed by melting curve analysis

• Include appropriate housekeeping genes for normalization

2. Immunohistochemistry/Immunofluorescence:

• Use validated antibodies specific to LDHB (avoid antibodies with cross-reactivity to LDHA unless performing comparative studies)

• For pancreatic tissue, co-staining with insulin (β cells) and glucagon (α cells) can provide cellular context, as LDHB is predominantly expressed in β cells

• Apply standardized quantification methods using 40× and 60× objectives

3. Western Blotting:

• Use validated antibodies with confirmed specificity (validation can be performed using siRNA knockdown controls)

• Include appropriate loading controls

• Quantify band intensity using standardized software

4. Single-cell RNA sequencing:

• This technique allows for cell-type specific expression analysis and has confirmed LDHB's predominant expression in β cells versus α cells within pancreatic islets

5. Mass Spectrometry:

• Tandem mass tag mass spectrometry provides protein-level confirmation and can be used to validate antibody specificity

Each method has specific strengths, and combining multiple approaches provides the most reliable results for LDHB expression analysis.

How does LDHB expression differ across human tissues and cell types?

LDHB shows distinct tissue- and cell-specific expression patterns in humans:

Pancreatic Expression:

• LDHB is specifically and highly expressed in β cells within the pancreatic islets

• By contrast, α cells predominantly express LDHA with minimal LDHB expression (approximately 81% of α cells lack detectable LDHB)

• A small subpopulation (approximately 19%) of α cells express high levels of LDHB, suggesting functional heterogeneity

• Similarly, about 26% of β cells show absent or low LDHB expression, indicating β cell heterogeneity

Cancer Cells:

• LDHB is necessary for basal autophagy and cancer cell proliferation in both oxidative and glycolytic cancer cells

• Expression patterns differ between cancer types, with some showing upregulation and others downregulation

Endocrine vs. Exocrine Pancreas:

• Human endocrine and exocrine pancreas both express LDH, with specific distribution patterns

• Immunohistochemistry shows LDHB is located throughout the cytoplasm in expressing cells

Other Tissues:

• Heart and red blood cells traditionally show higher LDHB expression

• Brain tissue also expresses significant LDHB

Understanding these expression patterns is crucial for interpreting research findings and developing targeted therapeutic approaches for metabolism-related diseases.

What are the key differences between LDHA and LDHB in human metabolism?

While LDHA and LDHB catalyze the same basic reaction, they exhibit important functional and regulatory differences:

In pancreatic islets, these differences contribute to metabolic compartmentalization, with LDHB limiting lactate generation in β cells to maintain appropriate insulin release . When LDHB is inhibited, LDHA-dependent lactate generation increases in both mouse and human β cells, resulting in increased basal insulin release .

This functional separation highlights how the two isoenzymes contribute to specialized metabolic programs in different cell types, with significant implications for understanding and targeting metabolic diseases.

How do LDHB inhibitors affect cellular metabolism and what are the methodological considerations for inhibitor studies?

LDHB inhibition produces complex effects on cellular metabolism that vary by cell type and metabolic context:

Effects on Lactate Production:

• In human pancreatic β cells, the selective LDHB inhibitor AXKO-0046 (10 μM) increases glucose-stimulated lactate generation by 10-20%

• This suggests LDHB normally restrains lactate production in these cells

• Similar effects are observed in mouse β cells, though they express lower levels of LDHB than human β cells

• By contrast, galloflavin (10 μM), which inhibits both LDHA and LDHB, impairs glucose-stimulated lactate generation

Methodological Considerations:

• Inhibitor Specificity:

  • AXKO-0046 is the first highly selective LDHB inhibitor (EC50 = 42 nM) with uncompetitive inhibition properties and no detectable activity against LDHA

  • X-ray crystallography shows it binds to a potential allosteric site away from the catalytic active site, targeting the tetramerization interface of two dimers

  • Researchers should validate specificity in their experimental system

• Real-time Metabolite Monitoring:

  • Use fluorescence resonance energy transfer (FRET) sensors for real-time lactate measurements

  • Ensure β cell-specific expression when studying heterogeneous tissues

• Controls and Concentrations:

  • Include both vehicle controls and non-selective inhibitors (e.g., galloflavin) for comparison

  • Verify effective concentrations in your specific cell type (standard: 10 μM AXKO-0046 for 2-hour pre-incubation)

• Downstream Effects:

  • Monitor insulin secretion when studying β cells, as LDHB inhibition increases basal insulin release

  • Consider incorporating 13C-glucose tracing to determine metabolic flux rerouting

The discovery that LDHB limits LDHA-dependent lactate generation suggests complex interplay between these isoenzymes that warrants careful experimental design when using inhibitors to study metabolic regulation.

What methodologies can be used to study the relationship between LDHB expression and insulin secretion in human β cells?

Investigating the LDHB-insulin secretion relationship requires specialized techniques:

1. Metabolic Flux Analysis:

• 13C6 glucose labeling coupled to gas chromatography-mass spectrometry (GC-MS) and 2D 1H-13C heteronuclear single quantum coherence (HSQC) NMR spectroscopy to map glucose metabolism

• These techniques revealed that lactate accumulation is 6-fold higher in human versus mouse islets

• Include time-course measurements to capture dynamic changes

2. Genetic Manipulation:

• siRNA knockdown of LDHB (validated to achieve ~3-fold reduction in EndoC-βH1 cells)

• CRISPR-Cas9 for generating knockout models

• Overexpression systems to assess dose-dependent effects

• Consider inducible systems for temporal control

3. Real-time Metabolite and Functional Measurements:

• β cell-specific lactate FRET sensors to monitor intracellular lactate in real-time

• Simultaneous calcium imaging to correlate metabolic changes with signaling events

• Perifusion systems for dynamic insulin secretion measurements

• Combine with selective LDHB inhibition using AXKO-0046 (10 μM)

4. Human Genetic Studies:

• cis-instrument Mendelian randomization to assess correlations between LDHB expression levels and fasting insulin

• Analysis showed that low LDHB expression levels correlate with elevated fasting insulin in humans

• This approach helps establish causal relationships in human populations

5. Single-cell Analysis:

• Single-cell RNA sequencing to identify heterogeneous β cell populations with varying LDHB expression

• Single-cell metabolomics to correlate LDHB levels with metabolite profiles

• Patch-clamp electrophysiology to link metabolic changes to electrical activity

These methodologies collectively demonstrate that LDHB restrains β cell lactate production and contributes to regulating basal/fasting insulin release, with implications for understanding metabolic disorders like diabetes.

What are the regulatory mechanisms controlling LDHB expression in human tissues, and how can they be experimentally investigated?

LDHB expression is regulated through multiple mechanisms that can be studied using specific approaches:

Transcriptional Regulation:

• Analysis of chromatin conformation and transcription factor binding reveals β cell-specific regulation of LDHB

• LDHB possesses two specific enhancers within CCCTC-binding factor boundaries, suggesting specialized regulatory control

• By contrast, LDHA shows open chromatin conformation and transcription factor binding to its promoter in human islets

Experimental Approaches:

• Chromatin Immunoprecipitation (ChIP):

  • Identify transcription factors binding to LDHB regulatory regions

  • Compare binding patterns across cell types with differential LDHB expression

• Assay for Transposase-Accessible Chromatin (ATAC-seq):

  • Map open chromatin regions in different cell types

  • Identify potential regulatory elements controlling cell-specific expression

• Chromosome Conformation Capture (3C/4C/Hi-C):

  • Determine three-dimensional interactions between LDHB enhancers and promoters

  • Characterize the role of CCCTC-binding factor boundaries in β cell-specific expression

• Reporter Assays:

  • Clone LDHB regulatory regions into reporter constructs

  • Test the activity of identified enhancers in different cell types

  • Perform site-directed mutagenesis to identify critical regulatory motifs

• Single-cell Multi-omics:

  • Correlate chromatin accessibility, transcription factor binding, and LDHB expression at single-cell resolution

  • Identify regulatory patterns in heterogeneous cell populations

Physiological Regulators:

• Metabolic stress conditions (high-fat diet) increase LDH expression ~2-fold in mouse islets

• Similar increases occur in the exocrine pancreas during high-fat diet feeding

Understanding these regulatory mechanisms may provide opportunities for therapeutic modulation of LDHB expression in metabolic diseases and cancer.

How can researchers effectively study LDHB function in human cancer metabolism?

LDHB plays critical roles in cancer metabolism that can be investigated through multiple approaches:

1. Functional Analysis in Cancer Cell Models:

• Selective inhibition using AXKO-0046 (EC50 = 42 nM) allows specific targeting of LDHB without affecting LDHA

• siRNA or CRISPR-based knockdown/knockout to assess cancer-specific dependencies

• Combine with metabolic flux analysis using 13C-labeled substrates to track metabolic rewiring

• Assess effects on autophagy, as LDHB is necessary for basal autophagy in cancer cells

2. Patient-Derived Models:

• Analyze LDHB expression in patient samples across cancer types and stages

• Develop patient-derived xenografts and organoids to maintain tumor heterogeneity

• Correlate LDHB expression with clinical outcomes and treatment responses

3. Mechanism Investigation:

• Investigate LDHB's role at the tetramerization interface, as X-ray crystallography revealed AXKO-0046 binds to a potential allosteric site away from the catalytic center

• Study how targeting this interface affects enzymatic activity and cancer cell metabolism

• Examine interactions between LDHB and other metabolic enzymes in the cancer context

4. Therapeutic Development:

• Use AXKO-0046 and derivatives to validate LDHB-associated pathways in cancer metabolism

• Develop combination approaches targeting both LDHA and LDHB

• Design therapeutic strategies based on cancer-specific metabolic vulnerabilities

5. Metabolic Imaging:

• Develop LDHB activity probes for non-invasive imaging

• Use hyperpolarized 13C-pyruvate MRI to assess LDH activity in vivo

• Correlate metabolic imaging with therapeutic responses

These approaches leverage the unique properties of LDHB inhibitors and the enzyme's distinct roles in cancer metabolism to develop targeted therapeutic strategies. The first selective LDHB inhibitor, AXKO-0046, represents an important tool for these investigations .

What approaches can be used to investigate species differences in LDHB function between human and mouse models?

Research has revealed significant species differences in LDHB expression and function, particularly in pancreatic islets. Investigating these differences requires specialized approaches:

Comparative Metabolic Analysis:

• 13C6 glucose labeling coupled to GC-MS and 2D 1H-13C HSQC NMR spectroscopy revealed that while both species convert pyruvate to lactate via LDH, lactate accumulation is unexpectedly 6-fold higher in human islets

• Despite differences in lactate production, the contribution of glucose to the TCA cycle is similar in both species

• Pyruvate fueling of the TCA cycle is primarily mediated by pyruvate dehydrogenase activity in both species, with limited contribution from pyruvate carboxylase

Expression Analysis Methodology:

• Immunohistochemistry shows LDH expression is lower in mouse compared to human islets

• Mouse LDHB expression increases ~2-fold after 8 weeks of high-fat diet feeding

• When designing comparative studies, account for these baseline differences

Functional Comparative Studies:

Experimental Design Considerations:

• Consistent Methodology:

  • Use identical experimental conditions when comparing species

  • Apply the same analytical techniques and quantification methods

• Translational Validation:

  • Verify findings from mouse models in human samples/cells

  • Consider using humanized mouse models for specific research questions

• Heterogeneity Assessment:

  • Account for heterogeneity within each species (e.g., the small subpopulation of mouse α cells with high LDHB expression)

  • Use single-cell approaches to capture population diversity

Understanding these species differences is crucial for translating findings from mouse models to human applications, particularly in metabolic disease research.

What are the optimal protocols for measuring LDHB enzymatic activity in human tissue samples?

Accurate measurement of LDHB activity requires specific considerations:

Spectrophotometric Assays:

• Reaction Direction:

  • LDHB preferentially catalyzes lactate to pyruvate conversion

  • For LDHB-specific activity, measure in the lactate → pyruvate direction

  • Monitor NAD+ reduction to NADH at 340 nm

• Reaction Conditions:

  • Buffer: pH 7.4-9.0 (optimum for lactate → pyruvate)

  • Temperature: 25°C or 37°C (consistently applied)

  • Substrate concentrations: 10-50 mM lactate, 1-2 mM NAD+

  • Include proper controls to account for background NADH production/consumption

• Isoenzyme Separation:

  • Use electrophoretic separation before activity measurements

  • Apply selective inhibitors: AXKO-0046 (LDHB-specific, 42 nM EC50)

  • Calculate relative contributions of LDHA and LDHB

Mass Spectrometry-Based Assays:

• Develop high-throughput mass spectrometry screening systems that detect NADH and NAD+ conversion

• This approach allows for higher sensitivity and specificity

• Apply similar reaction conditions as spectrophotometric assays

In Situ Activity Measurements:

• Use lactate FRET sensors for real-time activity monitoring in live cells

• Combine with LDHB inhibitors to determine specific contributions

• Apply glucose stimulation (17 mM) to assess dynamic changes in activity

Tissue-Specific Considerations:

• For pancreatic islets, isolate and culture tissue under standardized conditions

• Verify that isolation and culture time do not influence LDHB expression and activity

• For cancer samples, account for potential heterogeneity in expression

These methodological approaches provide comprehensive assessment of LDHB activity while distinguishing it from LDHA contribution.

How can researchers effectively design and interpret LDHB knockdown or knockout experiments in human cell lines?

Successful genetic manipulation studies of LDHB require careful experimental design:

Knockdown Approaches:

• siRNA Design:

  • Target specific LDHB sequences not present in LDHA

  • Validate knockdown efficiency by qPCR and Western blot

  • Achieved ~3-fold reduction in LDHB expression in EndoC-βH1 cells

• shRNA for Stable Knockdown:

  • Use inducible systems for temporal control

  • Select cell clones with verified knockdown efficiency

  • Monitor for potential compensatory upregulation of LDHA

CRISPR-Cas9 Knockout Strategy:

• Guide RNA Design:

  • Target LDHB-specific exons

  • Verify specificity to avoid off-target effects

  • Consider using paired nickases for increased specificity

• Validation Methods:

  • Genomic sequencing to confirm mutations

  • Western blot and qPCR to verify protein/mRNA loss

  • Enzymatic activity assays to confirm functional knockout

Controls and Interpretation:

• Essential Controls:

  • Non-targeting siRNA/shRNA or non-editing Cas9

  • LDHA knockdown for comparison

  • Rescue experiments with wild-type LDHB to verify specificity

• Metabolic Assessment:

  • Measure lactate production using FRET sensors or metabolomics

  • Analyze glucose uptake and utilization

  • Track TCA cycle metabolites using 13C-labeled substrates

• Functional Readouts:

  • For β cells: measure insulin secretion (basal and stimulated)

  • For cancer cells: assess proliferation, autophagy, and survival

  • Conduct experiments under both normal and stressed conditions

Potential Pitfalls:

• Compensatory mechanisms (e.g., LDHA upregulation)

• Incomplete knockdown masking phenotypes

• Cell type-specific dependencies affecting interpretation

Careful experimental design with appropriate controls and comprehensive functional analysis ensures valid interpretation of LDHB manipulation studies.

What are the recommended approaches for studying LDHB in human pancreatic islets and β cells?

Studying LDHB in human pancreatic tissue requires specialized techniques due to tissue scarcity and heterogeneity:

Ethical Considerations and Sample Acquisition:

• Studies must be approved by appropriate ethics committees

• Human islets can be obtained through clinical islet transplantation programs or organ procurement organizations

• Ensure proper consent and documentation for all human tissue research

Isolation and Culture:

• Islet Isolation:

  • Follow standardized protocols for pancreatic islet isolation

  • Verify that isolation and culture conditions do not alter LDHB expression or function

  • Document donor characteristics (age, sex, BMI, diabetes status)

• Cell Type Identification:

  • Co-stain for insulin (β cells) and glucagon (α cells) when studying LDHB

  • LDHB is predominantly expressed in β cells but shows heterogeneity

  • Approximately 26% of β cells show low/absent LDHB expression

Functional Analysis:

• Metabolic Flux Analysis:

  • Use 13C6 glucose labeling with GC-MS and 2D NMR spectroscopy

  • This approach revealed 6-fold higher lactate accumulation in human versus mouse islets

  • Track contributions to TCA cycle and lactate production

• Real-time Measurements:

  • Apply β cell-specific lactate FRET sensors for dynamic lactate monitoring

  • Use standardized glucose stimulation protocols (17 mM glucose)

  • Combine with calcium imaging for correlation with signaling events

• Pharmacological Manipulation:

  • AXKO-0046 (10 μM) for specific LDHB inhibition

  • Galloflavin (10 μM) for combined LDHA+LDHB inhibition

  • Pre-incubate for 2 hours before functional assessments

Advanced Single-cell Approaches:

• Single-cell Transcriptomics:

  • scRNA-seq confirmed β cell-specific expression of LDHB versus LDHA in α cells

  • Identify and characterize heterogeneous subpopulations

• Single-cell Proteomics:

  • Detect LDHB protein at single-cell resolution

  • Correlate with functional markers

These specialized approaches enable comprehensive investigation of LDHB's role in human pancreatic islet biology despite the inherent challenges of human tissue research.

How does LDHB contribute to metabolic disease pathophysiology and what are promising research directions?

LDHB's role in metabolic diseases represents an emerging research area with significant therapeutic potential:

Insulin Regulation and Diabetes:

• LDHB limits lactate generation in β cells to maintain appropriate insulin release

• LDHB inhibition increases basal insulin release in human β cells

• cis-instrument Mendelian randomization shows that low LDHB expression correlates with elevated fasting insulin in humans

Research Opportunities:

• Genetic Association Studies:

  • Expand Mendelian randomization analyses to diverse populations

  • Investigate LDHB polymorphisms associated with diabetes risk

  • Study epigenetic regulation of LDHB in metabolic disease contexts

• Therapeutic Targeting:

  • Explore LDHB modulators for diabetes management

  • Investigate cell type-specific delivery systems

  • Develop combination approaches targeting multiple metabolic enzymes

• Environmental Influences:

  • High-fat diet increases LDH expression ~2-fold in mouse pancreatic islets

  • Study how dietary patterns and obesity affect LDHB expression and function

  • Investigate potential reversibility of these changes

• β Cell Heterogeneity:

  • Approximately 26% of β cells show low/absent LDHB expression

  • Determine if this represents functional subpopulations with different metabolic properties

  • Study if this heterogeneity changes in diabetes progression

• Lactate Signaling:

  • Beyond its metabolic role, investigate if lactate acts as a signaling molecule

  • Study potential lactate receptors and downstream pathways in β cells

  • Examine paracrine effects of lactate in the islet microenvironment

These research directions may lead to novel therapeutic strategies for diabetes and other metabolic disorders by targeting LDHB-mediated regulation of lactate metabolism and insulin secretion.

What are the latest techniques for studying LDHB structure-function relationships and developing selective inhibitors?

Advanced techniques are driving progress in understanding LDHB structure and developing selective inhibitors:

Structural Analysis:

• X-ray Crystallography:

  • Revealed that the selective inhibitor AXKO-0046 binds to a potential allosteric site away from the LDHB catalytic active site

  • This binding targets the tetramerization interface of the two dimers, critical for enzymatic activity

  • Resolution of inhibitor-bound structures guides rational drug design

• Cryo-Electron Microscopy:

  • Enables visualization of LDHB in different conformational states

  • Provides insights into dynamic structural changes during catalysis

  • Allows study of large macromolecular complexes involving LDHB

• Molecular Dynamics Simulations:

  • Model LDHB conformational changes upon substrate/inhibitor binding

  • Predict binding sites and interaction energies

  • Guide rational design of selective inhibitors

Inhibitor Development:

• High-throughput Screening:

  • Mass spectrometry screening systems using LDHB enzyme assays that detect NADH and NAD+

  • This approach identified AXKO-0046, an indole derivative with selective LDHB inhibition (EC50 = 42 nM)

  • Screen diverse chemical libraries for novel scaffolds

• Structure-Based Design:

  • Target the tetramerization interface identified by X-ray crystallography

  • Focus on allosteric sites for isoform selectivity

  • Apply in silico docking and virtual screening approaches

• Medicinal Chemistry Optimization:

  • Develop AXKO-0046 derivatives to improve pharmacokinetic properties

  • Establish structure-activity relationships

  • Optimize selectivity, potency, and drug-like properties

Functional Validation:

• Enzyme Kinetics:

  • AXKO-0046 exhibits uncompetitive LDHB inhibition

  • Characterize inhibition mechanisms for new compounds

  • Determine isoform selectivity against LDHA

• Cellular Assays:

  • Validate effects on lactate production using FRET sensors

  • Confirm target engagement in cellular contexts

  • Assess effects on downstream biological processes

These advanced techniques continue to drive progress in understanding LDHB structure-function relationships and developing selective inhibitors with potential therapeutic applications.

What are the most promising future directions for LDHB research in human health and disease?

LDHB research is poised for significant advances with several promising directions:

Metabolic Disease Applications:

• Further elucidation of LDHB's role in regulating insulin secretion could lead to novel diabetes therapies

• Investigation of LDHB in other metabolic tissues beyond pancreatic islets

• Development of tissue-specific LDHB modulators for precision medicine approaches

Cancer Metabolism:

• Expanding the application of selective LDHB inhibitors like AXKO-0046 across cancer types

• Understanding the differential roles of LDHA and LDHB in various cancer metabolic phenotypes

• Developing combination therapies targeting metabolic vulnerabilities in cancer

Technological Innovations:

• Single-cell multi-omics to correlate LDHB expression with metabolic phenotypes

• Development of non-invasive imaging techniques to monitor LDHB activity in vivo

• Application of spatial transcriptomics to map LDHB expression in tissue microenvironments

Translational Opportunities:

• Using cis-instrument Mendelian randomization findings to identify high-risk populations based on LDHB expression

• Developing biomarkers based on LDHB activity or expression

• Creating patient-derived models to test personalized therapeutic approaches

Interdisciplinary Integration:

• Combining metabolomics, genomics, and clinical data to understand LDHB's role in complex diseases

• Applying systems biology approaches to model LDHB in metabolic networks

• Incorporating evolutionary perspectives on the specialized roles of LDH isoenzymes