IL 28A Human, His

What is IL-28A and how was it discovered?

IL-28A is a cytokine belonging to the interferon lambda family that plays a role in immune defense against viruses. It was discovered in 2002 by Zymogenetics through genomic screening processes where the entire human genome was scanned for putative genes followed by a second scan specifically looking for cytokines. Both IL-28 and IL-29 were identified in humans using this type of analysis . When conducting research with IL-28A, it's essential to understand its genomic location near IL-29 on chromosome 19 in humans, as this proximity may have implications for regulation and expression studies.

How does IL-28A differ from IL-28B and other interferons?

IL-28A and IL-28B are two isoforms of IL-28 that share 96% homology in their sequences . Despite this high similarity, they can exhibit different expression patterns and potentially distinct functions in certain contexts. IL-28A belongs to the type III interferon family, which shares many biological effects with type I interferons but with fewer side effects due to a more selective receptor distribution pattern . When designing experiments to study specific isoforms, researchers must use highly specific primers or antibodies that can distinguish between these closely related proteins, as cross-reactivity is a common challenge.

What receptor complex does IL-28A bind to and how does this affect its function?

IL-28A interacts with a heterodimeric class II cytokine receptor consisting of interleukin 10 receptor beta (IL10RB) and interleukin 28 receptor alpha (IL28RA) . This receptor specificity explains why IL-28A has more targeted effects compared to type I interferons. For functional studies, researchers should consider that the expression pattern of IL28RA largely determines which cell types will respond to IL-28A treatment, with significant expression in epithelial cells, particularly in the intestinal epithelium where IL-28A plays an important role in antiviral immune defense .

What are the optimal conditions for storing and reconstituting recombinant IL-28A protein?

Lyophilized IL-28A should be stored at -20°C to -80°C for long-term stability until the expiry date. It can be stored at room temperature for up to two weeks. After reconstitution as per the Certificate of Analysis, the protein can be stored at -20°C to -80°C for up to six months or at 4°C for one week . For optimal results, reconstitute the protein to 0.2 mg/mL in sterile 1× PBS (pH 7.4) containing 0.1% endotoxin-free recombinant human serum albumin (HSA) . Researchers should avoid repeated freeze-thaw cycles as these can significantly decrease protein activity. It's advisable to prepare single-use aliquots immediately after reconstitution.

How should I design qPCR experiments to quantify IL-28A expression?

When designing qPCR experiments for IL-28A, use validated primer pairs targeting the IL28A/IFNL2 gene. Commercially available primer sequences (Forward: TCGCTTCTGCTGAAGGACTGCA; Reverse: CCTCCAGAACCTTCAGCGTCAG) have been tested to generate satisfactory qPCR data . For optimal results, follow this PCR program: activation at 50°C for 2 min, pre-soak at 95°C for 10 min, followed by cycles of denaturation at 95°C for 15 sec and annealing at 60°C for 1 min, with a final melting curve analysis . Always include appropriate reference genes for normalization and consider that IL-28A expression may be induced in T cells upon activation with anti-CD2, anti-CD3, and anti-CD28 antibodies .

What cell types and activation conditions are most suitable for studying IL-28A functions?

T cells are particularly important for studying IL-28A as it acts as a T-cell autocrine factor. IL-28A transcripts in T cells can be induced by cell activation with anti-CD2, anti-CD3, and anti-CD28 antibodies . For studying differential effects, note that elevated IL-28A transcript levels have been observed in activated CD4+ T cells but not activated CD8+ T cells in patients with systemic lupus erythematosus (SLE) . When designing in vitro experiments, consider that IL-28A's biological activity is typically observed at concentrations of 0.01-0.06 ng/mL , which is significantly lower than many other cytokines, requiring careful titration in functional assays.

How does the quaternary structure of IL-28A affect its biological function?

IL-28A can form a homotetramer structure, with the first α-helix playing a crucial role in maintaining this conformation . Research has shown that this homotetrameric structure correlates positively with autolysosomal degradation of viral proteins such as HCV NS5A . When investigating structure-function relationships, consider using sequential deletion mutants focused on the first α-helix region to study the impact on homotetramer formation. Co-immunoprecipitation (Co-IP) and cell immunofluorescence techniques are effective methods for assessing IL-28A conformational states and their functional consequences. The table below summarizes key structural domains and their functions:

What signaling pathways are activated by IL-28A and how can they be studied?

IL-28A signaling primarily occurs through the JAK1/STAT1 pathway, which can be assessed through Western blot analysis of phosphorylated pathway components . When designing signaling studies, temporal dynamics are critical—early activation events may occur within minutes while downstream gene expression changes typically take hours. Researchers investigating IL-28A's role in autophagy should focus on changes in expression of autophagy-related genes like ATG3, ATG5, ATG7, ATG10, and LC3B . For comprehensive pathway analysis, consider combining Western blotting with transcriptomics approaches to capture both immediate signaling events and subsequent transcriptional responses.

How can I investigate the role of IL-28A in viral infections beyond HCV?

While much research has focused on IL-28A's role in HCV infection, its broad antiviral properties make it relevant for studying other viral infections. When designing studies for influenza, consider that IL-28A addition to vaccination has been shown to result in 100% protection from lethal H1N1 Influenza challenges in animal models . For HIV research, non-human primate models have confirmed IL-28A's ability to increase Interferon Gamma production and enhance CD8+ T cell cytotoxic activity . Methodologically, viral plaque reduction assays, viral load quantification by qPCR, and assessment of antiviral gene expression profiles (ISGs) are essential techniques when evaluating IL-28A's efficacy against different viruses.

What are the implications of IL-28A dysregulation in autoimmune diseases?

Research has shown that IL-28A expression is dysregulated in patients with systemic lupus erythematosus (SLE), with higher IL-28 transcript levels in activated CD4+ T cells compared to healthy controls . When studying autoimmune conditions, consider assessing both serum IL-28A protein levels by ELISA and IL-28A transcript levels in peripheral blood mononuclear cells (PBMCs) and T cells by RT-PCR. The detection frequency of IL-28A protein in serum is higher in SLE patients than in normal controls, suggesting potential as a biomarker . For comprehensive analysis, correlate IL-28A levels with established disease activity indices and other inflammatory markers.

How does IL-28A contribute to cardiovascular pathology in myocardial infarction?

Research has revealed that serum IL-28A levels in patients with acute myocardial infarction (AMI) are significantly elevated compared to normal controls, while IL-28B levels are significantly reduced . Both IL-28A and IL-28B levels demonstrate a linear relationship with high-density lipoprotein (HDL) and body mass index (BMI) . When investigating IL-28A's role in cardiovascular disease, consider approaches that combine clinical sample analysis with animal models. Experimental techniques should include echocardiography to assess cardiac function, histological analysis with HE staining to evaluate infarct areas, and immunofluorescence to detect expression patterns of IL-28A and its receptor in cardiac tissue.

What genetic polymorphisms in the IL-28A/B locus affect treatment response in viral diseases?

Single nucleotide polymorphisms (SNPs) near the IL28B gene have been identified as predictors of response to hepatitis C treatment with interferon and ribavirin . This finding represents one of the most clinically relevant outcomes from genome-wide association studies (GWAS). When investigating such polymorphisms, researchers should use genotyping assays specific for the relevant SNPs and correlate genotypes with treatment outcomes. Consider designing studies that examine both immediate antiviral responses (viral load reduction) and long-term outcomes (sustained virologic response). Analysis should account for potential confounding factors including viral genotype, baseline viral load, and patient demographics.

How can I distinguish between IL-28A and IL-28B in experimental settings?

Despite their 96% sequence homology, distinguishing between IL-28A and IL-28B is critical for specific functional studies. For gene expression analysis, use highly specific primers designed to target the few divergent regions between these isoforms . For protein detection, select antibodies validated for isoform specificity, and always confirm specificity using recombinant standards of both proteins. In functional studies, consider using recombinant proteins with different tags (e.g., His-tagged IL-28A vs. Flag-tagged IL-28B) to track their distinct activities. Knockout or knockdown approaches targeting each isoform specifically can provide definitive evidence of their individual contributions to biological processes.

What considerations are important when designing IL-28RA inhibition experiments?

When investigating the effects of IL-28RA inhibition, as in studies of myocardial infarction, lentiviral vectors have been successfully used to knock down IL-28RA expression in target tissues . Design appropriate control vectors (scrambled sequences) and validate knockdown efficiency at both mRNA and protein levels. For in vivo studies, consider local delivery methods such as intramyocardial injection to achieve tissue-specific effects . Functional readouts should include both molecular markers (e.g., JAK1/STAT1 pathway activation) and physiological parameters (e.g., cardiac function assessed by echocardiography). For comprehensive analysis, combine these approaches with apoptosis assessment using TUNEL staining and BAX/Bcl2 ratio determination to evaluate cell death mechanisms.