INTS7 Antibody

What is INTS7 and why is it significant in cancer research?

INTS7 is a component of the Integrator Complex that has been significantly implicated in cancer pathogenesis, particularly in lung adenocarcinoma (LUAD). LUAD represents the most common subtype of lung cancer, accounting for approximately 19.4% of all cancer deaths worldwide . Research has demonstrated that INTS7 expression is notably upregulated in LUAD tissues compared to adjacent normal tissues, and this elevated expression correlates with TNM stage and gender in LUAD patients . The significance of INTS7 in cancer research stems from its involvement in multiple cancer-related processes. Studies have shown that downregulation of INTS7 suppresses proliferation, invasion, and migration of lung cancer cells (specifically A549 cells), as well as inhibiting tumor growth in xenograft models . This multifaceted role in promoting cancer progression makes INTS7 an attractive target for both fundamental research and potential therapeutic interventions in oncology.

What experimental methods are most effective for detecting INTS7 expression?

When investigating INTS7 expression in research settings, multiple complementary techniques should be employed for robust validation. Real-time PCR represents a primary method for quantifying INTS7 mRNA levels, as demonstrated in studies utilizing the TRIzol reagent for RNA extraction followed by cDNA synthesis . The specific primer sequences recommended for INTS7 detection include forward: TGGCACTGGAACAAGATG and reverse: CAACTACTGACTGGCTAAGA, with GAPDH serving as a normalization control . For protein-level detection, Western blotting represents the gold standard, allowing researchers to quantify INTS7 protein abundance in cell lysates or tissue samples. Immunohistochemistry (IHC) on paraffin-embedded tissues provides spatial information about INTS7 expression patterns, requiring antigen retrieval in citrate buffer and blocking with 5% bovine serum albumin before overnight incubation with anti-INTS7 antibody at 4°C . Flow cytometry can also be employed for cellular-level quantification of INTS7 expression in suspension cells, providing information about expression heterogeneity across cell populations.

How should INTS7 antibodies be validated for experimental use?

Rigorous validation of INTS7 antibodies is essential for generating reliable research data. The validation process should begin with Western blot analysis using positive control samples known to express INTS7, such as A549 lung adenocarcinoma cells where INTS7 is known to be upregulated . The antibody should detect a band of the appropriate molecular weight for INTS7. Knockdown experiments using siRNA or shRNA targeting INTS7 provide critical negative controls, as demonstrated in studies where shRNA was effectively used to downregulate INTS7 expression in A549 cells . The validated antibody should show reduced signal intensity in these knockdown samples. Immunoprecipitation specificity should be confirmed by performing immunoprecipitation with the anti-INTS7 antibody followed by Western blot detection with the same or a different validated anti-INTS7 antibody targeting a distinct epitope . Cross-reactivity testing against similar proteins within the Integrator Complex family is also advisable to ensure specificity. Finally, comparing results across multiple INTS7 antibodies from different sources or those recognizing different epitopes provides additional validation stringency.

What are the primary applications of INTS7 antibodies in cancer research?

INTS7 antibodies serve multiple critical functions in cancer research, with immunoblotting representing a foundational application for quantifying INTS7 protein levels in various experimental conditions. This technique has been instrumental in establishing INTS7's role in cancer progression by demonstrating elevated expression in tumor tissues . Immunoprecipitation assays utilizing anti-INTS7 antibodies have proven valuable for investigating protein-protein interactions, as evidenced by studies identifying BAG3 as an interaction partner of INTS7 . Chromatin immunoprecipitation (ChIP) assays employing INTS7 antibodies enable researchers to identify genomic loci bound by INTS7, providing insights into its potential transcriptional regulatory functions. Immunohistochemistry and immunofluorescence techniques using anti-INTS7 antibodies permit visualization of INTS7 expression patterns within tissue sections and cellular compartments, facilitating correlation with pathological features and immune cell infiltration . Flow cytometry applications with INTS7 antibodies can assess expression levels across different cell populations, while INTS7 proximity ligation assays offer in situ visualization of protein interactions with potential binding partners like components of the p38MAPK pathway .

How can INTS7 antibodies be utilized to study protein-protein interactions?

Investigating protein-protein interactions involving INTS7 requires sophisticated immunological techniques centered around properly validated INTS7 antibodies. Co-immunoprecipitation (Co-IP) represents the gold standard approach, as demonstrated in studies where INTS7 was successfully co-immunoprecipitated with BAG3 to confirm their interaction in bone marrow mesenchymal stem cells (BMMSCs) . When designing Co-IP experiments, researchers should lyse cells with immunoprecipitation lysis buffer containing protease inhibitors to preserve protein interactions, then immunoprecipitate using anti-INTS7 antibody coupled to protein A/G beads . Western blotting of the immunoprecipitates with antibodies against potential binding partners can reveal specific interactions. Proximity ligation assays (PLA) offer an alternative approach that visualizes protein-protein interactions in situ, requiring pairs of antibodies against INTS7 and its suspected binding partners, followed by detection of close proximity (<40 nm) through rolling circle amplification and fluorescent probe hybridization. Structural prediction methods can complement antibody-based approaches, as seen in studies that used the Robetta web server to predict the three-dimensional structure of BAG3-INTS7 complexes before confirming with Co-IP . Finally, mass spectrometry analysis of INTS7 immunoprecipitates can identify novel interaction partners in an unbiased manner, providing insights into INTS7's functional network.

What protocols are optimal for studying INTS7's role in the p38MAPK pathway?

Investigating INTS7's involvement in the p38MAPK pathway requires carefully designed experimental approaches utilizing validated INTS7 antibodies. Western blot analysis represents a fundamental technique for this purpose, where researchers should examine phosphorylation levels of p38MAPK and its downstream targets following INTS7 knockdown or overexpression . Specifically, antibodies against phospho-p38MAPK, total p38MAPK, and downstream targets like ATF2 and MK2 should be employed to assess pathway activation. Co-immunoprecipitation assays using INTS7 antibodies followed by Western blotting for p38MAPK components can reveal direct physical interactions between INTS7 and pathway members. Kinase activity assays measuring p38MAPK activity in the presence or absence of INTS7 provide functional insights into this regulatory relationship. Rescue experiments where researchers introduce constitutively active or dominant-negative p38MAPK constructs into INTS7-depleted cells can determine whether p38MAPK mediates INTS7's effects on cell behavior . Importantly, bioinformatics analysis has already indicated that the p38MAPK pathway participates in the regulatory mechanism of INTS7 in lung adenocarcinoma, supporting the methodology of investigating this signaling axis .

How can INTS7 antibodies be applied in tumor microenvironment research?

INTS7 antibodies serve as crucial tools for investigating the complex relationships between INTS7 expression and the tumor microenvironment (TME). Multiplex immunofluorescence staining represents a powerful approach, where researchers can simultaneously detect INTS7 and various immune cell markers within tumor tissue sections . This technique has revealed significant correlations between INTS7 expression and specific immune populations - notably, negative correlations with memory B cells and mast cells, while showing positive correlations with M2 macrophage infiltration . Single-cell RNA sequencing analyses complemented by immunohistochemical validation with INTS7 antibodies can provide high-resolution insights into cell type-specific INTS7 expression patterns within the heterogeneous TME. Flow cytometry using INTS7 antibodies permits quantitative assessment of INTS7 expression across different cellular populations isolated from tumor tissues. Co-culture experiments where INTS7-manipulated tumor cells are grown with various immune cell populations can reveal functional interactions, with INTS7 antibodies used to track expression changes. Spatial transcriptomics combined with INTS7 immunostaining allows researchers to correlate INTS7 expression with specific microenvironmental niches and immune cell distributions within tumor tissues, providing valuable insights into how INTS7 may influence the immunological landscape of tumors.

What are the considerations when using INTS7 antibodies in mechanistic studies of cellular proliferation?

When investigating INTS7's role in cellular proliferation, researchers must consider several methodological factors to generate reliable and interpretable data. Cell viability assays such as CCK8, which has been successfully employed to measure proliferation changes following INTS7 knockdown in A549 cells, should be performed at multiple time points (24, 48, 72 hours) to capture the dynamic effects of INTS7 manipulation . Colony formation assays provide complementary data on long-term proliferative capacity, measuring both the number and size of colonies following INTS7 knockdown or overexpression. Cell cycle analysis using flow cytometry with propidium iodide staining should be conducted to determine whether INTS7 affects specific cell cycle phases, potentially explaining proliferation changes. EdU incorporation assays can directly measure DNA synthesis rates, providing insights into how INTS7 influences S-phase entry. For in vivo validation, xenograft mouse models have proven effective, as downregulation of INTS7 has been shown to suppress tumor growth in such models . When analyzing results, researchers should perform statistical comparisons between INTS7-manipulated cells and appropriate controls, and consider how INTS7's effects on proliferation might be mediated through specific signaling pathways like p38MAPK, which has been implicated in INTS7's regulatory mechanism .

How can INTS7 antibodies be used to investigate mechanisms of metastasis and invasion?

INTS7 antibodies serve as essential tools for dissecting the molecular mechanisms underlying metastasis and invasion in cancer research. Transwell invasion and migration assays represent foundational methods for assessing these phenotypes, as demonstrated in studies where downregulation of INTS7 significantly suppressed invasion and migration of A549 lung cancer cells . When conducting these assays, researchers should coat upper chambers with Matrigel for invasion assessment, while leaving chambers uncoated for migration studies, followed by quantification of cells that traverse the membrane after INTS7 manipulation. Wound healing assays provide complementary data on cell motility, measuring the rate of wound closure in monolayers of cells with altered INTS7 expression. Immunofluorescence staining using INTS7 antibodies, combined with markers of epithelial-mesenchymal transition (EMT) such as E-cadherin, N-cadherin, and vimentin, can reveal whether INTS7 promotes metastasis through EMT modulation. Western blotting analysis should be employed to quantify changes in metastasis-related proteins following INTS7 knockdown or overexpression, including matrix metalloproteinases (MMPs), tissue inhibitors of metalloproteinases (TIMPs), and key EMT transcription factors like Snail, Slug, and Twist. For clinical relevance, immunohistochemical staining with INTS7 antibodies in patient samples can correlate expression levels with metastatic status, as studies have already shown that increased INTS7 expression correlates with TNM stage in LUAD patients .

How can INTS7 antibodies be utilized in developing prognostic models for lung adenocarcinoma?

Developing robust prognostic models based on INTS7 expression requires sophisticated methodological approaches centered around properly validated INTS7 antibodies. Immunohistochemical (IHC) scoring of INTS7 in tumor tissue microarrays represents a primary technique, where researchers should establish standardized scoring systems based on staining intensity and percentage of positive cells . This approach enables correlation of INTS7 expression with clinical outcomes and pathological features. Kaplan-Meier survival analysis comparing patient groups stratified by INTS7 expression levels has already demonstrated that LUAD patients with high INTS7 expression have significantly worse prognosis than those with low expression . Multivariate Cox regression analysis should be performed to determine whether INTS7 represents an independent prognostic factor when accounting for established variables like age, gender, and TNM stage. For advanced model development, researchers can integrate INTS7 expression data with molecular and clinical parameters to construct nomograms for individualized survival probability estimation, as has been demonstrated with INTS7-derived risk scores . Combining INTS7 expression data with immune infiltration patterns using multiplex immunofluorescence can enhance prognostic accuracy, particularly given INTS7's established correlations with memory B cells, mast cells, and M2 macrophages . Finally, validation of prognostic models in independent patient cohorts is essential for establishing clinical utility.

What approaches are recommended for studying INTS7's relationship with reactive oxygen species (ROS)?

Investigating the relationship between INTS7 and reactive oxygen species (ROS) requires methodical approaches utilizing INTS7 antibodies alongside ROS detection techniques. Flow cytometry represents a primary method for quantifying intracellular ROS levels in cells with manipulated INTS7 expression, using fluorescent probes such as DCFDA (2',7'-dichlorofluorescin diacetate) or CellROX . This approach has demonstrated significant increases in ROS levels following BAG3 silencing, which affects INTS7 stability . Fluorescence microscopy using these same probes provides spatial information about ROS distribution within cells. Western blotting analysis should be performed to measure expression of antioxidant enzymes such as SOD1, SOD2, catalase, and glutathione peroxidase following INTS7 manipulation, revealing mechanisms by which INTS7 might regulate oxidative stress. Detection of oxidative damage markers like 8-OHdG (for DNA damage), protein carbonylation, or lipid peroxidation can provide evidence of functional consequences of INTS7-mediated ROS regulation. Rescue experiments using antioxidants such as N-acetylcysteine (NAC) can determine whether ROS mediates INTS7's effects on cellular phenotypes, as demonstrated in studies where NAC reversed the effects of BAG3 silencing (which affects INTS7 levels) on cell proliferation and migration . Specific investigation of γ-H2AX foci, a biomarker for DNA double-strand breaks, provides indirect evidence of oxidative stress, as significantly increased percentages of γ-H2AX-positive cells have been observed following manipulation of INTS7-related pathways .

What statistical approaches are recommended for analyzing INTS7 expression data in clinical samples?

Robust statistical analysis of INTS7 expression data in clinical samples requires appropriate methodologies tailored to the specific experimental design. For comparing INTS7 expression between tumor and adjacent normal tissues, paired t-tests are recommended when samples are matched, while unpaired t-tests or Mann-Whitney U tests are appropriate for unmatched samples, depending on data distribution . When examining associations between INTS7 expression and categorical clinical variables (such as gender, TNM stage, or histological grade), chi-square tests or Fisher's exact tests should be employed as demonstrated in studies correlating INTS7 expression with TNM stage and gender in LUAD patients . Survival analysis represents a critical component of INTS7 clinical studies, with Kaplan-Meier curves and log-rank tests being the standard approach for comparing outcomes between high and low INTS7 expression groups . To assess INTS7's value as an independent prognostic factor, multivariate Cox regression analysis must be performed, adjusting for established prognostic factors. For constructing predictive nomograms incorporating INTS7 expression, researchers should employ Cox proportional hazards regression models and assess model performance using concordance index (C-index) and calibration plots . When integrating INTS7 expression with immune infiltration data, correlation analyses (Pearson or Spearman, depending on data distribution) should be used to examine relationships between INTS7 levels and different immune cell populations .

How might single-cell approaches enhance INTS7 antibody research?

Single-cell technologies offer unprecedented opportunities to advance INTS7 research beyond traditional bulk analysis methods. Single-cell RNA sequencing (scRNA-seq) combined with antibody-based protein detection (CITE-seq) represents a powerful approach for simultaneously examining INTS7 expression at both transcript and protein levels across heterogeneous cell populations within tumors . This methodology could reveal previously unrecognized cell type-specific expression patterns and functions of INTS7. Single-cell spatial transcriptomics integrated with INTS7 immunofluorescence staining would enable mapping of INTS7 expression within the spatial context of the tumor microenvironment, potentially identifying specialized niches where INTS7 expression is particularly relevant to cancer progression. Mass cytometry (CyTOF) using metal-conjugated INTS7 antibodies could facilitate high-dimensional analysis of INTS7 protein expression alongside numerous other markers, enabling comprehensive phenotyping of INTS7-expressing cells. Single-cell ATAC-seq (Assay for Transposase-Accessible Chromatin) combined with INTS7 ChIP-seq could reveal cell type-specific chromatin landscapes associated with INTS7 function, providing insights into its transcriptional regulatory mechanisms. Single-cell proteomics approaches may soon enable comprehensive protein expression profiling at the single-cell level, offering new opportunities to understand post-translational modifications and protein interactions involving INTS7 across diverse cell populations within the tumor ecosystem.

What novel therapeutic approaches targeting INTS7 are being investigated?

Emerging therapeutic approaches targeting INTS7 represent an exciting frontier in cancer research, with several strategies showing potential based on current understanding of INTS7 biology. RNA interference (RNAi) approaches, including siRNA and shRNA, have demonstrated efficacy in experimental settings, as evidenced by successful suppression of proliferation, invasion, and migration of lung cancer cells following INTS7 knockdown . These findings support the development of RNA-based therapeutics for clinical applications. CRISPR-Cas9 genome editing offers precise targeting of INTS7, potentially enabling complete knockout or specific mutations that could disrupt its oncogenic functions while minimizing off-target effects. Small molecule inhibitors designed to disrupt INTS7's protein-protein interactions, particularly with critical partners like BAG3, represent another promising approach . High-throughput screening of compound libraries could identify molecules that specifically block these interactions. Targeting the p38MAPK pathway, which has been implicated in INTS7's regulatory mechanism, provides an indirect approach to modulating INTS7 function, with several p38MAPK inhibitors already in clinical development . Immunotherapeutic approaches may benefit from INTS7-based stratification, as INTS7 expression correlates with immune cell infiltration patterns that could predict immunotherapy response . Personalized medicine approaches incorporating INTS7-derived genomic prognostic models could help guide treatment decisions, as demonstrated by nomograms that include INTS7-derived risk scores for estimating individual survival probability .