ITGB3BP Human

What is ITGB3BP and how is it expressed in normal versus glioma tissues?

ITGB3BP (Integrin Beta 3 Binding Protein) is a gene that shows significantly higher expression in glioma tissues compared to normal brain tissues. Analysis of data from multiple databases including GEPIA (which included 163 high-grade glioma samples and 207 normal brain samples) demonstrates consistent upregulation of ITGB3BP at the mRNA level in glioma tissues . RT-qPCR verification confirmed significantly higher ITGB3BP expression in glioma cell lines (T98, U251, and A172) and glioma tissues compared to normal human astrocytes and normal brain tissues, suggesting a potential role in tumor development . Interestingly, protein expression data from immunohistochemistry (IHC) did not show the same significant increase in protein levels as observed at the mRNA level, indicating potential post-transcriptional regulation .

What techniques are most effective for measuring ITGB3BP expression in research?

Multiple complementary techniques have been validated for ITGB3BP detection and quantification:

• RT-qPCR: This method effectively quantifies ITGB3BP mRNA expression in both cell lines and tissue samples. Research protocols use GAPDH expression as a normalization control with specific primers: ITGB3BP-Forward: GCGTTTCCTTTGGCGGATTT, ITGB3BP-Reverse: AGTGATCTTTTAACAGGCATTCTGA .

• RNA-Seq and Microarray Analysis: Large-scale transcriptomic profiling provides comprehensive expression data across different tumor grades and in comparison to normal tissues. These methods were used to analyze 2222 glioma patients in the study cited .

• Immunohistochemistry (IHC): Used to detect protein expression in tissue samples, though results showed less significant differences than mRNA methods in the referenced studies .

• Bioinformatic Analysis: Tools such as GEPIA (Gene Expression Profiling Interactive Analysis) and the Human Protein Atlas databases offer valuable resources for analyzing ITGB3BP expression across different tissues and cancer types .

How does ITGB3BP expression correlate with WHO glioma grades?

ITGB3BP expression shows a positive correlation with WHO glioma grades, with expression levels increasing as the grade increases. Statistical analysis using Wilcoxon and Kruskal-Wallis tests demonstrated that:

• Grade IV glioma (glioblastoma) exhibits significantly higher ITGB3BP expression than grade III glioma (anaplastic astrocytoma, anaplastic oligodendroglioma, and anaplastic oligoastrocytoma) .

• Grade III glioma shows higher ITGB3BP expression than grade II glioma (astrocytoma, oligodendroglioma, and oligoastrocytoma) .

This progressive increase in expression with higher tumor grades suggests that ITGB3BP may play a role in glioma progression and malignancy, making it a potential marker for tumor aggressiveness .

What signaling pathways are activated by high ITGB3BP expression in glioma?

Gene Set Enrichment Analysis (GSEA) revealed that high ITGB3BP expression activates multiple oncogenic signaling pathways in glioma. Data from three different databases (CGGA-Seq, CGGA microarray, and TCGA-Seq) showed remarkable consistency in pathway activation:

All four pathways (cell cycle, DNA replication, mismatch repair, and homologous recombination) showed significant activation (NES > 1.5, p < 0.05) in the high ITGB3BP expression group . Activation of these pathways is known to promote malignant progression of tumor cells, suggesting mechanisms by which ITGB3BP contributes to glioma pathogenesis and poor prognosis .

How does ITGB3BP expression correlate with specific genetic alterations in glioma?

ITGB3BP expression shows significant relationships with key genetic alterations that are important in glioma classification and prognosis:

• IDH Mutation Status: ITGB3BP expression is significantly lower in IDH-mutant gliomas compared to IDH wild-type gliomas. Since IDH mutations are generally associated with better prognosis, this inverse relationship supports ITGB3BP's association with poor outcomes .

• 1p19q Co-deletion: Gliomas with 1p19q co-deletion, which is typically associated with improved survival, show significantly lower ITGB3BP expression compared to non-co-deleted tumors .

These correlations further support ITGB3BP as a potential marker for molecular classification of gliomas and suggest that its expression may be regulated by or associated with these genetic alterations that define distinct molecular subtypes of glioma .

What is the relationship between ITGB3BP expression and immune cell infiltration in glioma?

Analysis using the TIMER database revealed complex relationships between ITGB3BP expression and immune cell infiltration that differ between glioma subtypes:

• In Glioblastoma (GBM):

  • Positive correlation with CD8+ T cell infiltration (r = 0.099, p = 0.0422)

  • Negative correlation with CD4+ T cell infiltration

  • Negative correlation with CD274 (PD-L1) expression

• In Lower-Grade Glioma (LGG):

  • Positive correlation with infiltration of multiple immune cell types:

    • B cells

    • CD8+ T cells

    • CD4+ T cells

    • Neutrophils

    • Macrophages

    • Dendritic cells

  • Positive correlation with immune checkpoint genes CD274 (PD-L1), PDCD1 (PD-1), and PDCD1LG2 (PD-L2)

These differences highlight the heterogeneity between GBM and LGG in terms of immune microenvironment and suggest that ITGB3BP may play different roles in immune regulation depending on glioma grade . This has potential implications for immunotherapy strategies targeting different glioma subtypes.

How can ITGB3BP be utilized as a prognostic biomarker in glioma patients?

ITGB3BP shows strong potential as a prognostic biomarker for glioma:

These findings suggest that ITGB3BP expression analysis could be integrated into clinical prognostic assessment for glioma patients to help guide treatment decisions and follow-up strategies.

What approaches should be used to investigate potential therapeutic targeting of ITGB3BP in glioma?

Based on current research, several methodological approaches can be employed to investigate ITGB3BP as a therapeutic target:

• Small Molecule Inhibitor Screening: The cited research identified hexestrol as a potential small-molecule drug that may specifically inhibit ITGB3BP and could be useful in glioma treatment . Similar screening approaches using chemical libraries can identify additional compounds with ITGB3BP-inhibitory activity.

• RNA Interference (RNAi) and CRISPR-Cas9: These gene-editing technologies can be used to knock down or knock out ITGB3BP in glioma cell lines and patient-derived xenografts to assess effects on tumor growth, invasion, and response to therapy.

• Pathway-Based Approaches: Given that ITGB3BP activates cell cycle, DNA replication, mismatch repair, and homologous recombination pathways , combination approaches targeting both ITGB3BP and these downstream pathways may be more effective than single-target approaches.

• Immune Modulation: Given the correlations between ITGB3BP and immune cell infiltration , studies investigating combinations of ITGB3BP inhibition with immunotherapies (particularly in the context of immune checkpoint inhibitors) could be valuable.

• Patient Stratification: Methodologies for patient selection in clinical trials should consider ITGB3BP expression levels along with IDH mutation status and 1p19q co-deletion status to identify those most likely to benefit from ITGB3BP-targeted therapies .

How can researchers reconcile the discrepancy between ITGB3BP mRNA and protein expression in glioma?

The research noted an interesting discrepancy: while ITGB3BP mRNA was significantly overexpressed in glioma compared to normal brain tissue, protein levels assessed by immunohistochemistry did not show the same significant increase . To investigate this discrepancy, researchers should consider:

• Post-transcriptional Regulation Assessment:

  • Analysis of microRNA regulation of ITGB3BP

  • RNA stability assays to determine if ITGB3BP mRNA has altered stability in glioma cells

  • Polysome profiling to assess translational efficiency

• Protein Degradation Studies:

  • Proteasome inhibition experiments to determine if ITGB3BP protein undergoes accelerated degradation

  • Ubiquitination assays to assess post-translational modifications

  • Pulse-chase experiments to measure protein half-life

• Technical Validation:

  • Use of multiple antibodies targeting different epitopes of ITGB3BP

  • Western blot analysis in addition to IHC

  • Mass spectrometry-based proteomics for unbiased protein quantification

• Subcellular Localization Studies:

  • Immunofluorescence and subcellular fractionation to determine if ITGB3BP protein localization differs between normal and glioma cells

  • Assessment of potential protein sequestration in specific cellular compartments

Understanding this mRNA-protein discrepancy could provide insights into novel regulatory mechanisms and potentially identify additional therapeutic targets in the ITGB3BP pathway.

How might ITGB3BP expression analysis be integrated into clinical glioma management?

Integration of ITGB3BP expression analysis into clinical practice could enhance glioma management in several ways:

Implementation would require standardization of detection methods (RT-qPCR or RNA-Seq), establishment of expression thresholds for clinical decision-making, and prospective clinical trials to validate the clinical utility of ITGB3BP-based diagnostic and treatment algorithms.

What is the optimal experimental design for validating ITGB3BP as a therapeutic target in glioma?

A comprehensive approach to validating ITGB3BP as a therapeutic target should include:

• In Vitro Functional Studies:

  • ITGB3BP knockdown and overexpression in multiple glioma cell lines

  • Assessment of effects on proliferation, apoptosis, invasion, and migration

  • Analysis of changes in activated signaling pathways (cell cycle, DNA replication, etc.)

  • Evaluation of combinatorial approaches with standard-of-care treatments

• In Vivo Models:

  • Orthotopic xenograft models using ITGB3BP-modulated cell lines

  • Patient-derived xenografts with varying levels of ITGB3BP expression

  • Genetically engineered mouse models incorporating ITGB3BP alterations

  • Assessment of tumor growth, invasion, and survival outcomes

  • Evaluation of blood-brain barrier penetration of potential ITGB3BP inhibitors

• Translational Biomarker Studies:

  • Correlation of ITGB3BP expression with response to various therapies in retrospective patient cohorts

  • Development and validation of companion diagnostic assays

  • Identification of additional biomarkers that may predict response to ITGB3BP-targeted therapy

• Early-Phase Clinical Trial Design:

  • Basket trials including glioma patients stratified by ITGB3BP expression

  • Incorporation of pharmacodynamic endpoints to confirm target engagement

  • Serial biopsies to assess changes in pathway activation and immune infiltration

  • Combined approaches targeting both ITGB3BP and its downstream effectors

This multi-faceted approach would provide comprehensive validation of ITGB3BP as a therapeutic target and establish the foundation for clinical development of ITGB3BP-targeted therapies in glioma.