ITSN1 Antibody, HRP conjugated

What is ITSN1 and why is it a significant research target?

ITSN1 (Intersectin 1) is a multidomain scaffolding protein that contributes to actin cytoskeleton reconstruction and plays critical roles in endocytosis and signaling pathways. Its significance as a research target stems from its involvement in various biological processes, particularly in breast carcinoma where it has been identified through comprehensive bioinformatic analysis as a potential biomarker . ITSN1 contains multiple protein-protein interaction domains, including SH3 domains that facilitate binding to synaptojanin1 and endophilin, making it a crucial regulatory platform in cellular processes . The biological significance and diverse functions of ITSN1 have made antibodies against this protein essential tools for investigating its roles in normal physiology and disease states.

What are the key experimental applications for ITSN1 antibodies?

ITSN1 antibodies are versatile tools applicable across multiple experimental platforms. The primary applications include Western blotting (WB) for protein expression quantification, immunoprecipitation (IP) for protein-protein interaction studies, immunohistochemistry (IHC) for tissue localization, and immunocytochemistry (ICC) for cellular distribution analysis . Additionally, enzyme-linked immunosorbent assay (ELISA) provides quantitative measurement of ITSN1 levels in various samples. When selecting an ITSN1 antibody for your research, consider the specific experimental requirements, target species, and whether the antibody has been validated for your application of interest. For instance, the antibody described in search result (ABIN7444238) has been validated for WB, IP, IHC, and ICC applications in rat samples with cross-reactivity to mouse.

What advantages does HRP conjugation offer for ITSN1 detection?

HRP (horseradish peroxidase) conjugation to ITSN1 antibodies provides several methodological advantages in research applications. The direct enzyme conjugation eliminates the need for secondary antibody incubation, thereby reducing protocol time, minimizing background signals, and lowering cross-reactivity risks. This is particularly beneficial in multi-labeling experiments where antibodies from the same host species must be used simultaneously. HRP-conjugated antibodies also offer enhanced sensitivity through signal amplification via the enzymatic reaction, which is especially valuable when detecting low-abundance proteins like ITSN1 in certain tissues or experimental conditions . The HRP enzyme catalyzes reactions with substrates such as TMB, DAB, or enhanced chemiluminescence reagents, providing flexible detection options for different visualization requirements.

How should researchers validate the specificity of ITSN1 antibodies before experimental use?

Proper validation of ITSN1 antibodies is essential for ensuring experimental reliability. Begin with positive and negative control samples - tissues or cell lines known to express or lack ITSN1, respectively. For Western blotting, verify that the antibody detects bands at the expected molecular weight (~195.4 kDa for full-length ITSN1) , though be aware that splice variants may produce bands of different sizes. Consider using ITSN1 knockout or knockdown samples as definitive negative controls. For immunohistochemistry or immunocytochemistry applications, compare staining patterns with published literature and perform peptide competition assays. When validating HRP-conjugated ITSN1 antibodies specifically, include additional controls to account for potential non-specific binding or enzymatic activity interference. Documenting thorough validation procedures is critical for publication quality and experimental reproducibility.

What are the optimal experimental conditions for Western blotting with HRP-conjugated ITSN1 antibodies?

When performing Western blotting with HRP-conjugated ITSN1 antibodies, several parameters require optimization for optimal results. Begin with sample preparation, ensuring complete protein extraction using a buffer containing protease inhibitors to prevent ITSN1 degradation. For gel electrophoresis, use 7-8% polyacrylamide gels to adequately resolve the high molecular weight ITSN1 protein (~195.4 kDa) . Transfer proteins to a PVDF membrane (preferred over nitrocellulose for high molecular weight proteins) using a wet transfer system with lower methanol concentration (10%) and extended transfer time (overnight at 30V, 4°C). For blocking, 5% non-fat dry milk in TBST is generally effective, though some HRP-conjugated antibodies may perform better with specialized blocking reagents. Optimize the primary antibody dilution through titration experiments, typically starting at 1:1000. Since the antibody is already HRP-conjugated, proceed directly to detection after primary antibody incubation and washing steps. Enhanced chemiluminescence (ECL) detection provides suitable sensitivity for most ITSN1 applications, though enhanced ECL substrates may be necessary for detecting low expression levels.

How can researchers optimize immunohistochemistry protocols for ITSN1 detection in tissue samples?

Optimizing immunohistochemistry (IHC) protocols for ITSN1 detection requires careful consideration of several factors. Tissue fixation is critical - 10% neutral buffered formalin for 24-48 hours is standard, but overfixation can mask ITSN1 epitopes. Antigen retrieval is essential; for ITSN1, heat-induced epitope retrieval using citrate buffer (pH 6.0) typically yields good results, though some epitopes may require EDTA buffer (pH 9.0) . For HRP-conjugated ITSN1 antibodies, endogenous peroxidase activity must be quenched thoroughly using 3% hydrogen peroxide for 10-15 minutes before antibody application. The optimal antibody dilution should be determined empirically, usually ranging from 1:100 to 1:500 for most commercial ITSN1 antibodies. Incubation conditions significantly impact staining quality; overnight incubation at 4°C often produces more specific staining than shorter incubations at room temperature. For visualization, DAB (3,3'-diaminobenzidine) substrate is commonly used with HRP-conjugated antibodies, with development time requiring careful monitoring to prevent background while ensuring adequate signal intensity.

What strategies can improve immunoprecipitation efficiency when studying ITSN1 interactions?

Improving immunoprecipitation (IP) efficiency for ITSN1 interaction studies requires optimization at multiple steps. Cell lysis conditions are critical - use buffers containing 1% NP-40 or Triton X-100 with protease inhibitors, maintaining protein complexes while effectively solubilizing membrane-associated ITSN1. Pre-clearing lysates with protein A/G beads reduces non-specific binding. When using HRP-conjugated ITSN1 antibodies for IP, consider the potential steric hindrance from the HRP molecule; alternatively, use non-conjugated antibodies for the IP step and HRP-conjugated antibodies for detection. Cross-linking the antibody to beads using dimethyl pimelimidate prevents antibody co-elution with the target protein, resulting in cleaner results. For studying transient or weak ITSN1 interactions, chemical crosslinking of protein complexes prior to lysis (using formaldehyde or DSP) can preserve interactions that might otherwise be lost during IP procedures . Elution conditions should be optimized based on downstream applications; gentle elution with peptide competition may be preferable for maintaining native protein complexes compared to harsher SDS elution methods.

How should researchers design RT-PCR experiments to correlate ITSN1 mRNA expression with protein levels?

When designing RT-PCR experiments to correlate ITSN1 mRNA with protein levels, several methodological considerations are essential. Begin with simultaneous extraction of RNA and protein from the same samples to minimize variation. For RNA extraction, TRIzol reagent followed by column purification ensures high-quality RNA suitable for RT-PCR analysis . When designing primers, target conserved regions of ITSN1 mRNA that span multiple exons to prevent genomic DNA amplification. The primers used in previous studies (forward: TATCCTGGCAATGCACCTCA, reverse: AACTGGTTCCTCTGGTAGCC) have been validated for ITSN1 detection . Quantitative RT-PCR should employ the 2−∆∆Ct method with GAPDH as an internal reference gene, though multiple reference genes provide more reliable normalization. Amplification conditions should follow established protocols: 95°C for 10 minutes followed by 40 cycles of 95°C for 15 seconds and 60°C for 45 seconds . For protein correlation, extract protein from parallel samples and perform Western blot analysis using HRP-conjugated ITSN1 antibodies. Statistical correlation between mRNA and protein levels should employ Pearson or Spearman correlation coefficients depending on data distribution characteristics.

How can multicolor immunofluorescence be optimized when using HRP-conjugated ITSN1 antibodies with other markers?

Optimizing multicolor immunofluorescence with HRP-conjugated ITSN1 antibodies requires strategic planning to overcome technical challenges. Since direct HRP conjugation is primarily designed for chromogenic rather than fluorescent detection, researchers must employ tyramide signal amplification (TSA) to generate fluorescent signals. In this approach, the HRP enzyme catalyzes the deposition of fluorophore-labeled tyramide in close proximity to the antibody binding site. Begin by determining the optimal sequential staining order, generally placing HRP-conjugated antibodies first in the sequence. Complete HRP inactivation between markers is critical - thorough peroxidase quenching using hydrogen peroxide (3%, 15-20 minutes) after each TSA reaction prevents signal carryover. For multi-labeling experiments, select fluorophores with minimal spectral overlap and include appropriate controls to verify specificity of each signal. When studying ITSN1 co-localization with synaptic proteins, for example, careful titration of each antibody minimizes background while maintaining detection sensitivity. Confocal microscopy with sequential scanning further reduces potential crosstalk between channels. Additionally, automated spectral unmixing algorithms can help separate overlapping fluorescent signals during image analysis.

What strategies address epitope masking issues when detecting ITSN1 in complex with binding partners?

Epitope masking presents a significant challenge when detecting ITSN1 in protein complexes, particularly when studying its interactions with endophilin, synaptojanin1, and other binding partners . Several methodological approaches can address this issue. First, employ multiple antibodies targeting different ITSN1 epitopes to increase detection probability regardless of protein-protein interactions. The availability of antibodies recognizing different regions (N-terminal, middle region, or C-terminal domains) facilitates this approach . Second, consider modified fixation and permeabilization protocols - milder fixatives like paraformaldehyde at lower concentrations (2% instead of 4%) and shorter incubation times may preserve antigenicity while maintaining structural integrity. Third, epitope retrieval techniques can be adapted specifically for protein complex detection: for formaldehyde-fixed samples, try extended heat-induced epitope retrieval (40 minutes instead of 20) or enzymatic retrieval using proteases like proteinase K at carefully titrated concentrations. Fourth, proximity ligation assays (PLA) offer an alternative approach that converts protein-protein interactions into detectable fluorescent signals, potentially circumventing epitope accessibility issues altogether. Finally, native protein extraction methods maintaining protein complexes followed by size-exclusion chromatography prior to immunodetection can provide insights into ITSN1's interaction status.

How can researchers quantitatively analyze ITSN1 expression across different experimental conditions?

Quantitative analysis of ITSN1 expression requires rigorous methodological approaches to ensure reliable comparisons across experimental conditions. For Western blot quantification, use housekeeping proteins (β-actin, GAPDH) as loading controls while being aware of their potential regulation under certain experimental conditions; alternatively, total protein normalization using stain-free technology provides a more reliable reference. Densitometric analysis should employ linear range determination for both ITSN1 and reference signals, avoiding saturated pixels that compromise quantification accuracy. For immunohistochemistry quantification, consider employing digital image analysis with algorithms capable of recognizing cellular compartments and quantifying staining intensity within defined regions. The H-score method, which accounts for both staining intensity and percentage of positive cells, provides robust semi-quantitative assessment . For flow cytometry applications, standardized fluorescent beads enable consistent instrument calibration across experiments. When studying ITSN1 expression in patient samples, statistical approaches must account for inter-patient variability; techniques like relative expression analysis using the 2−∆∆Ct method have been validated for ITSN1 quantification . For all quantitative analyses, appropriate statistical tests should be selected based on data distribution, with one-way ANOVA used for multiple group comparisons of ITSN1 expression across different experimental conditions .

What are the considerations for detecting specific ITSN1 isoforms using HRP-conjugated antibodies?

Detecting specific ITSN1 isoforms presents unique challenges that require careful antibody selection and experimental design. ITSN1 exists in two major isoforms: the ubiquitously expressed ITSN1-S (short) and the neuron-specific ITSN1-L (long) with its additional C-terminal RhoGEF, PH, and C2 domains . When selecting HRP-conjugated antibodies for isoform-specific detection, evaluate the immunogen sequence carefully - antibodies raised against amino acids 1-227 will detect both isoforms, while those targeting the C-terminal extension (beyond amino acid 1220) will be specific for ITSN1-L . For Western blotting applications, use lower percentage gels (6%) with extended run times to adequately separate the different molecular weight isoforms (ITSN1-S: ~145 kDa; ITSN1-L: ~195 kDa). For RT-PCR-based isoform detection, design primers spanning isoform-specific exon junctions. When interpreting immunohistochemistry results, remember that tissue-specific expression patterns exist - neuronal tissues express both isoforms while non-neuronal tissues predominantly express ITSN1-S. For verification of isoform specificity, consider using tissues from knockout models or cell lines with CRISPR-mediated isoform-specific modifications as definitive controls.

How can researchers troubleshoot weak or absent signals when using HRP-conjugated ITSN1 antibodies?

Weak or absent signals when using HRP-conjugated ITSN1 antibodies can result from multiple factors requiring systematic troubleshooting. First, verify antibody activity by dot blot analysis with purified ITSN1 protein or positive control lysates. For Western blotting applications, inadequate protein extraction can limit detection - optimize lysis buffers (consider RIPA buffer with protease inhibitors) and extend extraction time. If using frozen antibody aliquots, multiple freeze-thaw cycles might have compromised HRP activity; prepare fresh working dilutions from concentrated stocks. For tissue sections, insufficient antigen retrieval frequently causes weak signals - extend heating time or try alternative retrieval buffers. The HRP enzyme is sensitive to sodium azide; ensure all buffers used with HRP-conjugated antibodies are azide-free. For chromogenic detection, substrate depletion can occur if the reaction proceeds too long; prepare fresh substrate solution and optimize development time. If signals remain weak, signal amplification systems like tyramide signal amplification (TSA) can enhance sensitivity by 10-100 fold. Finally, consider potential epitope masking due to protein-protein interactions or post-translational modifications affecting the target region of your ITSN1 antibody .

What controls are essential for validating experimental results with ITSN1 antibodies?

Rigorous control implementation is essential for validating experimental results with ITSN1 antibodies. Positive controls should include samples known to express ITSN1, such as brain tissue for ITSN1-L or BT-549 breast cancer cells which have been validated in previous studies . Negative controls should include tissues or cells with confirmed absence of ITSN1 expression; ideally, ITSN1 knockdown samples created through siRNA (using validated sequences like 5ʹ-GCAUGAUCAGCAGUUCCAUAGUUUA-3ʹ) provide definitive negative controls. For Western blotting, additional controls include molecular weight markers to confirm band size and loading controls for normalization. For immunohistochemistry applications, include isotype controls matching the primary antibody's host species and immunoglobulin class to identify non-specific binding. Peptide competition assays, where the antibody is pre-incubated with immunizing peptide, provide compelling evidence of specific binding when the signal is abolished. For HRP-conjugated antibodies specifically, include enzyme-only controls (HRP without antibody) to identify potential non-specific enzymatic activity. Multi-method validation, where ITSN1 detection is confirmed using complementary techniques (e.g., immunoblotting, immunohistochemistry, and RT-PCR), strengthens result interpretation .

How should researchers interpret inconsistencies between ITSN1 protein detection and functional assays?

Interpreting inconsistencies between ITSN1 protein detection and functional assays requires careful consideration of several potential explanations. First, post-translational modifications might alter ITSN1 function without affecting detection by certain antibodies; phosphorylation status particularly influences ITSN1's scaffolding capabilities and protein interactions . Second, consider protein localization changes - ITSN1 may redistribute between cellular compartments under various conditions, maintaining total protein levels while altering functional availability at specific sites. Third, protein complex formation can sequester ITSN1 in functionally distinct pools; for example, ITSN1's binding to endophilin and synaptojanin1 significantly impacts its role in endocytic pathways . Fourth, evaluate whether your detection method captures all relevant isoforms - functional assays may be influenced by specific isoforms not recognized by your antibody. Fifth, temporal dynamics must be considered - protein levels and functional activity often exhibit different time courses following stimulation or inhibition. To resolve these inconsistencies, employ multiple detection approaches targeting different ITSN1 epitopes, utilize subcellular fractionation to assess compartment-specific changes, and perform co-immunoprecipitation studies to evaluate protein-protein interaction status. Additionally, complementary methodologies like proximity ligation assays can directly visualize protein interactions, potentially explaining functional discrepancies.

What considerations apply when comparing ITSN1 detection results across different antibody formats (including HRP-conjugated vs. unconjugated)?

When comparing ITSN1 detection results across different antibody formats, several methodological considerations are critical for accurate interpretation. First, conjugation status directly impacts detection sensitivity and specificity - HRP-conjugated antibodies eliminate secondary antibody variability but may exhibit reduced antigen binding capacity due to steric hindrance from the conjugated enzyme. Second, epitope accessibility varies between applications; unconjugated antibodies paired with secondary detection might access certain epitopes more effectively than directly conjugated versions. Third, signal amplification differs significantly - indirect detection with unconjugated primary and secondary antibodies provides natural signal amplification (multiple secondary antibodies binding each primary), whereas HRP-conjugated antibodies have 1:1 enzyme:antibody ratio unless tyramide amplification is employed. Fourth, protocol optimization requirements vary - optimal dilutions, incubation times, and buffer compositions differ substantially between conjugated and unconjugated formats. Fifth, lot-to-lot variability effects can be compounded by conjugation processes, potentially introducing additional inconsistency sources. For cross-format validation, researchers should process identical samples in parallel with both formats, include appropriate controls for each detection system, and establish normalization methods appropriate to each detection approach. When reporting results, clearly document the specific antibody format, catalog number, and detection methodology to enable appropriate result interpretation and experimental reproduction.

How can ITSN1 antibodies be effectively utilized in breast cancer research models?

ITSN1 antibodies offer valuable tools for investigating breast cancer biology based on ITSN1's role in actin cytoskeleton reconstruction and potential as a prognostic biomarker . For effective utilization in breast cancer research, several methodological approaches deserve consideration. Immunohistochemical analysis of breast cancer tissue microarrays using HRP-conjugated ITSN1 antibodies enables correlation between ITSN1 expression patterns and clinicopathological characteristics. Previous studies have established standardized scoring methods where relative ITSN1 expression >1.3 (derived from mean values of 24 samples) is considered high expression . For in vitro models, ITSN1 knockdown experiments in breast cancer cell lines like BT-549 using validated siRNA sequences allow functional assessment of ITSN1's role in proliferation, migration, and invasion capabilities. Cell viability, apoptosis, and proliferation can be quantified using established assays including CCK-8, flow cytometry, and colony formation assays respectively . For mechanistic studies, co-immunoprecipitation with ITSN1 antibodies followed by mass spectrometry enables identification of novel interaction partners in breast cancer contexts. Finally, dual immunofluorescence staining for ITSN1 alongside established breast cancer markers (ER, PR, HER2) provides insights into subtype-specific expression patterns and potential therapeutic implications.

What approaches optimize ITSN1 detection in neurological research applications?

Neurological research applications require specialized approaches for optimal ITSN1 detection due to the neuron-specific expression of the ITSN1-L isoform and ITSN1's critical roles in synaptic vesicle recycling and endocytosis . For brain tissue immunohistochemistry, perfusion fixation with 4% paraformaldehyde followed by post-fixation optimization is essential for preserving delicate neural structures while maintaining epitope accessibility. When studying synaptic localization, super-resolution microscopy (STED, STORM) provides the necessary resolution to visualize ITSN1 distribution within small synaptic compartments. For biochemical analyses of synaptic fractions, careful subcellular fractionation protocols can separate synaptic clathrin-coated vesicles (CCV) for ITSN1 quantification, revealing its differential recruitment to canonical CCV (canCCV) versus synaptic CCV (stCCV) . When investigating ITSN1's interactions with synaptic proteins, proximity ligation assays offer single-molecule resolution of protein-protein interactions within intact neural circuits. For functional studies in neurons, shRNA-mediated ITSN1 knockdown followed by electrophysiological recordings enables correlation between ITSN1 levels and synaptic transmission parameters. Finally, for developmental studies, temporally controlled conditional knockout models provide insights into stage-specific ITSN1 functions in neuronal development and maturation.

What emerging technologies are enhancing ITSN1 detection sensitivity and specificity?

Several emerging technologies are revolutionizing ITSN1 detection capabilities in research applications. Single-molecule detection methods, including single-molecule pull-down (SiMPull) and single-molecule fluorescence resonance energy transfer (smFRET), are enabling visualization of individual ITSN1 molecules and their conformational changes upon binding partner interactions. Nanobody-based detection, using camelid-derived single-domain antibody fragments conjugated to HRP or fluorophores, offers superior tissue penetration and reduced steric hindrance for accessing ITSN1 epitopes in complex cellular environments. Mass cytometry (CyTOF) employing metal-tagged antibodies against ITSN1 and its binding partners permits simultaneous detection of dozens of proteins in single cells without spectral overlap limitations. For ultrastructural localization, genetically encoded peroxidases (APEX) fused to ITSN1 enable electron microscopy visualization of ITSN1 with nanometer resolution. Finally, advanced tissue clearing techniques (CLARITY, iDISCO+) combined with light-sheet microscopy allow three-dimensional visualization of ITSN1 distribution throughout intact tissues and organs. These emerging technologies are significantly expanding our ability to detect ITSN1 with unprecedented sensitivity, specificity, and spatial-temporal resolution in increasingly complex biological systems.