KAT7 Antibody

What is KAT7 and what are its primary cellular functions?

KAT7, also known as HBO1 or MYST2, is a histone acetyltransferase involved in critical epigenetic processes. It functions primarily in chromatin remodeling and transcriptional activation, playing crucial roles in regulating gene expression. KAT7 is particularly important in cell cycle progression and DNA repair mechanisms . The protein contains several functional domains, including an N-terminal serine-rich domain (1-170aa), a small zinc finger (ZF) domain in the middle region (171-329aa), and a C-terminal MYST domain with histone acetyltransferase activity (330-611aa) .

Recent research has revealed KAT7's involvement in various pathological conditions, with dysregulation of KAT7 being implicated in cancer development and progression. For instance, upregulation of KAT7 has been observed in colorectal cancer tissues and associated with poor patient survival outcomes .

How is KAT7 protein regulated within cells?

KAT7 protein levels are tightly regulated through post-translational modifications that affect its stability. One important regulatory mechanism involves phosphorylation by Protein Kinase D1 (PKD1). This phosphorylation enhances KAT7 protein stability by reducing its ubiquitination-mediated degradation through the proteasome pathway .

Which application methods are most effective for KAT7 antibody detection?

KAT7 antibodies have been validated and optimized for multiple experimental applications. Based on the technical information provided, the following applications and dilutions have proven effective:

When performing these applications, it's important to note that KAT7 primarily localizes to the nucleus and nucleoplasm . Positive controls that have been validated include BT-474, HepG2, 293T, and HeLa cell lines, which all express detectable levels of endogenous KAT7 .

How can I detect KAT7 phosphorylation sites experimentally?

Detecting KAT7 phosphorylation requires specific methodological approaches. Based on published protocols, the following method has been successfully employed:

• In vitro kinase assay:

  • Incubate 2 μg of GST-KAT7 and 8 μg of purified kinase (e.g., HA-PKD1-CA) in kinase buffer for 30 minutes at 30°C with 200 μM ATP

  • Stop the reaction by adding SDS loading buffer

  • Analyze phosphorylation by Western blotting using anti-phosphoserine or anti-phosphothreonine antibodies

• Mass spectrometry identification:

  • Resolve the reaction products by SDS-PAGE

  • Stain gels with Coomassie Blue

  • Retrieve the protein bands corresponding to KAT7

  • Perform mass spectrometry analysis to identify specific phosphorylation sites

This approach has successfully identified serine and threonine residues in KAT7 that are phosphorylated by PKD1, providing valuable insights into KAT7 regulation.

What methods are effective for studying protein-protein interactions involving KAT7?

Several complementary approaches have proven effective for investigating KAT7 interactions with other proteins:

• Co-immunoprecipitation (Co-IP):

  • For exogenous protein interactions: Co-transfect cells with tagged KAT7 (e.g., FLAG-KAT7) and the potential interacting protein (e.g., HA-PKD1)

  • For endogenous interactions: Use antibodies specific to endogenous KAT7 and the protein of interest

  • Perform reciprocal Co-IP using antibodies against each tag or protein

  • Analyze by Western blotting

• GST-pulldown assay:

  • Express and purify GST-tagged KAT7 or deletion mutants

  • Incubate with cell lysates containing the protein of interest or with purified protein

  • Capture complexes using glutathione-sepharose beads

  • Analyze bound proteins by Western blotting

• Domain mapping:

  • Generate deletion mutants of KAT7 (e.g., GST-KAT7 fragments covering different domains)

  • Use these in pulldown assays to determine which regions mediate specific interactions

  • For example, studies have shown that the 171-329aa region of KAT7 is critical for binding to PKD1

These methods can be combined to provide robust evidence of protein-protein interactions and identify the specific domains involved.

How can I accurately measure KAT7 protein stability and half-life?

Measuring protein stability and half-life is crucial for understanding KAT7 regulation. The cycloheximide (CHX) chase assay has been effectively used for this purpose:

• Experimental procedure:

  • Transfect cells with constructs of interest (e.g., empty vector, PKD1 expression vector, or siRNA against PKD1)

  • After 48 hours, treat cells with cycloheximide (100 μg/ml) to inhibit new protein synthesis

  • Harvest cells at specific time points (e.g., 0, 2, 4, and 8 hours after CHX treatment)

  • Prepare whole cell lysates and analyze 25 μg of total protein by Western blotting with anti-KAT7 antibody

  • Quantify KAT7 protein levels using image analysis software (e.g., Image J) and normalize to a loading control such as tubulin

• Data analysis:

  • Plot normalized KAT7 protein levels against time to generate a decay curve

  • Calculate the half-life as the time point at which protein levels decrease to 50% of the initial amount

  • Compare half-life values under different experimental conditions to assess factors affecting KAT7 stability

This approach has revealed that PKD1 significantly influences KAT7 stability, with PKD1 overexpression extending KAT7's half-life beyond 8 hours and PKD1 knockdown reducing it to less than 2 hours .

What approaches are recommended for KAT7 knockdown and knockout studies?

Several genetic manipulation approaches have been validated for studying the functional consequences of KAT7 depletion:

• shRNA-mediated knockdown:

  • Design lentiviral shRNAs targeting distinct regions of human KAT7

  • Transduce target cells with lentiviral particles

  • After 24 hours, replace with fresh complete medium

  • Select stable transfectants with puromycin (2.0 μg/mL) for approximately 10 days

  • Verify knockdown efficiency by Western blot analysis

• CRISPR/Cas9-mediated knockout:

  • Design sgRNAs targeting the human KAT7 gene (e.g., sgKAT7-1: GATGAACGAGTCTGCCGAAG; sgKAT7-2: AACGATACTCCGCCGGCACA)

  • Clone sgRNAs into a lenti-CRISPR-GFP vector

  • Transfect cells using Lipofectamine 3000

  • Sort GFP-positive cells by flow cytometry 72 hours post-transfection

  • Perform single-cell cloning

  • Verify knockout by Western blot analysis

• Functional validation:

  • Conduct phenotypic assays to assess the effects of KAT7 depletion

  • Examples include cell viability assays (CCK-8), proliferation assays (cell counting, EdU incorporation), apoptosis analysis (flow cytometry), and migration/invasion assays (wound-healing, transwell)

  • Analyze changes in protein expression of relevant pathways using Western blotting

Studies have demonstrated that KAT7 knockdown or knockout in colorectal cancer cells leads to decreased viability, suppressed proliferation, increased apoptosis, and reduced migration and invasion capabilities .

How can I optimize Western blot detection of KAT7?

Optimizing Western blot detection of KAT7 requires attention to several experimental parameters:

• Sample preparation:

  • Use freshly prepared cell lysates when possible

  • Include protease inhibitors in lysis buffers to prevent degradation

  • For phosphorylation studies, include phosphatase inhibitors

  • Load adequate protein amount (25-30 μg per lane is typically sufficient)

• Antibody selection and dilution:

  • Use verified KAT7 antibodies with known epitope recognition

  • Start with recommended dilutions (1:500 - 1:2000) and optimize if needed

  • Consider using antibodies raised against different epitopes for confirmation

  • The expected molecular weight of KAT7 is approximately 70.6 kDa

• Detection and controls:

  • Include positive control lysates from cells known to express KAT7 (e.g., BT-474, HepG2, 293T, HeLa)

  • For knockdown/knockout validation studies, include appropriate controls (scrambled shRNA, non-targeting sgRNA)

  • Normalize KAT7 levels to a stable housekeeping protein such as tubulin

• Specialized applications:

  • For detecting phosphorylated KAT7, use phospho-specific antibodies or general anti-phosphoserine/threonine antibodies following immunoprecipitation

  • For protein stability studies, ensure complete protein synthesis inhibition with appropriate CHX concentrations

What considerations are important for immunofluorescence studies with KAT7 antibodies?

Immunofluorescence studies require specific optimization to accurately detect KAT7 localization:

• Fixation and permeabilization:

  • KAT7 is primarily localized to the nucleus and nucleoplasm

  • Use appropriate fixation methods (4% paraformaldehyde is commonly effective)

  • Ensure adequate permeabilization to allow antibody access to nuclear proteins

• Antibody dilution and incubation:

  • Start with recommended dilutions (1:50 - 1:200) for immunofluorescence

  • Optimize incubation time and temperature

  • Use appropriate blocking reagents to minimize background

• Controls and validation:

  • Include negative controls (secondary antibody only, isotype control)

  • Consider using KAT7 knockdown or knockout cells as specificity controls

  • Co-stain with nuclear markers to confirm expected localization

• Analysis considerations:

  • Look for primarily nuclear staining pattern

  • Assess signal intensity and distribution

  • Consider quantitative analysis of signal intensity relative to nuclear markers

How can I optimize co-immunoprecipitation experiments for studying KAT7 interactions?

Co-immunoprecipitation is a powerful technique for studying KAT7 protein interactions but requires careful optimization:

• Experimental design:

  • Perform reciprocal Co-IP experiments (immunoprecipitate with antibodies against each protein of interest)

  • Include appropriate controls (IgG control, lysate input)

  • Consider both endogenous and exogenous (tagged) protein approaches

• Protocol optimization:

  • Use mild lysis conditions to preserve protein-protein interactions

  • Adjust antibody amounts and incubation conditions

  • Consider crosslinking if interactions are transient or weak

  • Use appropriate beads (Protein A/G, anti-tag beads) depending on the antibody

• Validation approaches:

  • Confirm interactions using alternative methods (GST-pulldown, proximity ligation assay)

  • Map interaction domains using deletion mutants

  • Assess functional significance by disrupting the interaction

Published studies have successfully used these approaches to demonstrate direct interaction between KAT7 and PKD1, mapping the interaction to specific domains of KAT7 .

How are KAT7 antibodies being used to study cancer progression mechanisms?

KAT7 antibodies have become valuable tools in cancer research, particularly for understanding epigenetic mechanisms in tumor progression:

• Expression analysis in cancer tissues:

  • Immunohistochemistry using KAT7 antibodies has revealed increased expression in colorectal cancer tissues compared to adjacent normal tissues

  • These findings correlate with poor patient survival outcomes

• Mechanistic studies:

  • Western blot analysis following KAT7 manipulation has helped elucidate its role in regulating apoptosis-related proteins

  • In colorectal cancer cells, KAT7 knockdown led to changes in expression of apoptotic markers

  • KAT7 manipulation also affects EMT-related proteins, with knockout leading to upregulation of E-cadherin and downregulation of N-cadherin, Snail, and Vimentin

• Therapeutic target assessment:

  • KAT7 antibodies enable monitoring of target engagement in studies evaluating potential therapeutic approaches

  • Correlation of KAT7 expression with clinical outcomes helps identify patient populations that might benefit from targeting this pathway

What methodologies can determine if KAT7 modifications affect its enzymatic activity?

Understanding how post-translational modifications affect KAT7 enzymatic activity requires specialized approaches:

• In vitro histone acetyltransferase (HAT) assays:

  • Immunoprecipitate KAT7 from cells under different conditions (e.g., with or without PKD1 overexpression)

  • Incubate with core histones or histone peptides and acetyl-CoA

  • Detect acetylation using acetylation-specific antibodies or radioactive assays

• Chromatin immunoprecipitation (ChIP) approaches:

  • Use KAT7 antibodies to immunoprecipitate chromatin

  • Analyze histone acetylation at KAT7-bound regions

  • Compare acetylation levels when KAT7 is modified (e.g., phosphorylated) versus unmodified

• Structure-function analysis:

  • Generate KAT7 mutants with modifications at specific sites (e.g., phosphomimetic mutations)

  • Compare enzymatic activity of wild-type and mutant KAT7

  • Correlate structural changes with functional outcomes

These approaches can provide insights into how modifications like PKD1-mediated phosphorylation affect not only KAT7 stability but also its enzymatic activity and target specificity.