KCNE3 Antibody

What is KCNE3 and why is it important in ion channel research?

KCNE3 (Potassium Voltage-Gated Channel Subfamily E Regulatory Subunit 3) is a critical accessory protein that modulates the function of several potassium channels. Most notably, KCNE3 interacts with the voltage-gated potassium channel KCNQ1, where it removes voltage-dependent gating, transforming KCNQ1 from a voltage-dependent channel into a constitutively open leak channel . This regulatory function makes KCNE3 important in tissues requiring continuous potassium recycling. Additionally, KCNE3 has been implicated in Brugada Syndrome, making it an important target for cardiac arrhythmia research . The study of KCNE3 provides valuable insights into ion channel modulation and associated pathologies.

What types of KCNE3 antibodies are available for research applications?

Several types of KCNE3 antibodies are commercially available for research applications:

• Unconjugated primary antibodies: These include polyclonal antibodies from various hosts such as goat and rabbit that target different epitopes of KCNE3 .

• Conjugated antibodies: FITC-conjugated KCNE3 antibodies are available for fluorescence-based applications with excitation/emission wavelengths of 499/515 nm .

• Species-specific antibodies: Antibodies with reactivity to human, mouse, cow, and dog KCNE3 are available .

Most KCNE3 antibodies are generated against specific regions of the protein, such as the internal region or the N-terminal segment (1-57AA) .

What experimental techniques commonly employ KCNE3 antibodies?

KCNE3 antibodies are employed in several experimental techniques:

• Immunohistochemistry (IHC): For localizing KCNE3 protein in tissue sections .

• ELISA (Enzyme-Linked Immunosorbent Assay): For quantitative measurement of KCNE3 protein levels .

• Western Blotting: For detecting KCNE3 protein in cell or tissue lysates, often used at dilutions of 1:200 .

• Co-immunoprecipitation: For studying protein-protein interactions between KCNE3 and ion channels such as Kv4.3 .

• Immunofluorescence: Using conjugated antibodies like FITC-KCNE3 for localization studies .

How should KCNE3 antibodies be stored and handled?

For optimal maintenance of antibody activity, KCNE3 antibodies should be:

• Stored at -20°C in aliquots to avoid repeated freeze-thaw cycles.

• Protected from light exposure, especially fluorophore-conjugated antibodies like FITC-KCNE3.

• Stored in appropriate buffer conditions (typically 0.01 M PBS, pH 7.4 with stabilizers like glycerol at 50% and preservatives like 0.03% Proclin-300) .

• Thawed completely before use and mixed gently to ensure homogeneity.

Proper storage ensures antibody integrity and experimental reproducibility for long-term research projects.

How can I validate the specificity of KCNE3 antibodies in my experimental system?

Rigorous validation of KCNE3 antibodies is critical for reliable research outcomes. Consider these validation strategies:

• Peptide competition assay: Co-incubate the primary antibody with its specific antigenic peptide to block binding to the target protein. For example, with the Santa Cruz SC-10647 antibody, the corresponding antigenic peptide (SC-10647-P) can be used at a ratio of 20:1 (Ag:Ab) .

• Negative controls:

  • Omit primary antibody in immunostaining

  • Use tissues or cells known to lack KCNE3 expression

  • Include immunoprecipitation reactions with Protein-A beads but without primary antibody to exclude non-specific adsorption

• Positive controls:

  • Use tissue samples known to express KCNE3, such as human atrial samples

  • Include recombinant KCNE3 protein as a standard

• Cross-species validation: Confirm antibody reactivity across species if your research spans multiple animal models, noting that some antibodies show cross-reactivity with human, mouse, cow, and dog KCNE3 .

What are the optimal conditions for co-immunoprecipitation of KCNE3 with channel partners?

Co-immunoprecipitation (co-IP) is valuable for studying KCNE3 interactions with channel proteins. Based on published protocols:

• Crosslinking considerations:

  • For membrane protein interactions like KCNE3 with Kv4.3, evaluate the need for membrane-permeable crosslinkers

  • Control experiments should be performed both with and without crosslinkers like bis(sulfosuccinimidyl) suberate (BS³)

  • Include experiments to exclude non-specific cross-linking reactions

• Antibody selection:

  • Choose antibodies with validated specificity for co-IP (e.g., anti-KCNE3 from Santa Cruz at 1:200 dilution)

  • Ensure the epitope recognized by the antibody is not involved in protein-protein interactions

• Detection strategy:

  • Use chemiluminescence with ECL detection kits for sensitive detection

  • Appropriate secondary antibodies (e.g., anti-goat at 1:2500 for KCNE3 detection)

  • Sequential immunoblotting with antibodies for both interaction partners

• Controls:

  • Input control (pre-immunoprecipitation lysate)

  • Negative control (non-relevant antibody)

  • Beads-only control to assess non-specific binding

How do mutations in KCNE3 affect its interaction with potassium channels?

The impact of KCNE3 mutations on channel interactions has significant implications for channelopathies. The R99H mutation in KCNE3 provides an instructive example:

• Differential effects on channel partners:

  • R99H-KCNE3 co-expressed with KCNQ1 shows no alteration in current magnitude or kinetics

  • R99H-KCNE3 co-expressed with KCND3 (Kv4.3) results in significantly increased Ito intensity compared to wild-type KCNE3+KCND3

• Experimental approaches to study mutation effects:

  • Whole-cell patch clamp studies in heterologous expression systems (e.g., CHO-K1 cells)

  • Co-transfection of wild-type or mutant KCNE3 with channel partners

  • Use of reporter genes like CD8 or GFP to identify transfected cells

• Clinical correlation:

  • The R99H mutation was found in 4/4 phenotype-positive and 0/3 phenotype-negative family members in a Brugada Syndrome cohort

  • Suggests functional significance of the mutation in disease pathogenesis

What NMR techniques are useful for studying KCNE3 structure and membrane topology?

Nuclear Magnetic Resonance (NMR) spectroscopy offers powerful tools for studying KCNE3 structure and dynamics:

• Residual Dipolar Couplings (RDCs):

  • Measured using KCNE3-bicelle complexes aligned in strained polyacrylamide gels

  • Provides information about orientation of structural elements

• Paramagnetic Relaxation Enhancement (PRE):

  • Requires spin-labeling of single-cysteine mutant forms of KCNE3 (e.g., Ser13Cys, Ser57Cys, Ser74Cys, or Ser82Cys)

  • Uses MTSL (1-oxyl-2,2,5,5-tetramethylpyrroline-3-methyl-methanethiosulfonate) as the spin label

  • Diamagnetic reference spectra acquired after quenching with ascorbic acid

• Relaxation measurements:

  • T₁, T₂, and ¹⁵N-(¹H)-NOE parameters measured on ¹⁵N-labeled KCNE3

  • Provides information about protein dynamics

• Membrane topology assessment:

  • Accessibility to lipophilic probes (16-DSA) versus water-soluble probes (Gd-DTPA)

  • Hydrogen-deuterium exchange experiments to probe water accessibility

These NMR approaches provide complementary structural and dynamic information, essential for understanding KCNE3 function in membrane environments.

What are the considerations for using KCNE3 antibodies in different experimental applications?

Different applications require specific considerations when using KCNE3 antibodies:

What strategies can address weak or nonspecific KCNE3 antibody signals?

When encountering signal issues with KCNE3 antibodies, consider these approaches:

• For weak signals:

  • Optimize antibody concentration (titrate from recommended dilutions)

  • Extend incubation time or adjust temperature

  • Enhance detection system sensitivity (amplification steps, more sensitive substrates)

  • Increase protein loading for Western blots

  • Optimize antigen retrieval for IHC

• For nonspecific signals:

  • Increase blocking stringency (5% BSA or milk proteins)

  • Optimize washing steps (longer, more frequent washes)

  • Reduce primary antibody concentration

  • Pre-adsorb antibody with tissues/cells lacking KCNE3

  • Use more specific detection methods

• For membrane proteins like KCNE3:

  • Optimize membrane protein extraction conditions

  • Consider native vs. denaturing conditions based on epitope accessibility

  • Test different detergents for solubilization

How can I design experiments to study KCNE3 interaction with different channel partners?

Investigating KCNE3's modulatory effects on different ion channels requires careful experimental design:

• Expression system selection:

  • Heterologous systems (CHO-K1, HEK293) for controlled expression

  • Native tissues (human atrial samples) for physiological relevance

• Co-transfection approaches:

  • Optimal DNA ratios (e.g., 2 μg KCNQ1 with 1 μg KCNE3, or 1.5 μg each for Kv4.3 and KCNE3)

  • Include reporter genes (CD8, GFP) for transfected cell identification

  • Use appropriate transfection reagents (FuGENE6 for CHO cells)

• Functional assessment:

  • Whole-cell patch clamp for electrophysiological characterization

  • Compare current properties with/without KCNE3 co-expression

  • Analyze both wild-type and mutant KCNE3 effects

• Biochemical interaction evidence:

  • Co-immunoprecipitation from both heterologous systems and native tissues

  • Proximity ligation assays for in situ interaction detection

  • FRET/BRET for dynamic interaction studies

What methods are recommended for KCNE3 gene mutation screening in research populations?

For comprehensive KCNE3 genetic analysis, consider these approaches:

• PCR and screening methods:

  • Single-strand conformation polymorphism (SSCP) for initial screening

  • Restriction enzyme analysis (e.g., BstEII digestion) to generate appropriately sized fragments

  • Primers designed based on exon sequences of KCNE3

• Sequencing approaches:

  • Direct sequencing of PCR products showing aberrant conformers

  • Use of genetic analyzers like 3100-Avant with big dye chemistry

  • Next-generation sequencing for high-throughput analysis

• Primer design considerations:

  • Include restriction enzyme sequences for subsequent cloning

  • Example KCNE3 primers:

    • Forward: GGAAGATCTGCTAGCGCCGCCATGGAGACTACCAATGGAACGGAGAC

    • Reverse: CCGCTCGAGGGATCCTTAGATCATAGACACACGGTTCTTG

• Sample processing:

  • DNA extraction from blood using standardized kits (e.g., QIAamp DNA Blood Mini Kit)

  • PCR optimization (33 cycles at 60°C annealing temperature has been successful)

How can I correlate KCNE3 gene variants with functional channel alterations?

To establish genotype-phenotype correlations for KCNE3 variants:

• Functional expression systems:

  • Create expression vectors containing wild-type and mutant KCNE3 (e.g., using pIRES2-AcGFP1 vector)

  • Co-express with relevant channel partners (KCNQ1, KCND3)

  • Use appropriate host cells (CHO-K1 cells have been successful)

• Electrophysiological characterization:

  • Whole-cell patch clamp studies 48 hours post-transfection

  • Compare current magnitude, activation/inactivation kinetics, and voltage dependence

  • Temperature control during recording (temperature-controlled chamber)

• Statistical analysis:

  • Present data as Mean ± S.E.M.

  • Use appropriate statistical tests (Student's t-test or ANOVA followed by Student-Newman-Keuls test)

  • Consider p<0.05 as statistically significant

• Clinical correlation:

  • Analyze segregation of variants with disease phenotype in families

  • Compare functional effects with clinical presentation

  • Consider environmental and genetic modifiers

What techniques are available for studying KCNE3 structure and its complexes with channel proteins?

Multiple complementary techniques provide structural insights into KCNE3:

• NMR spectroscopy approaches:

  • Solution NMR of KCNE3 in membrane-mimetic environments (bicelles)

  • Data collection at 600-900 MHz using Bruker spectrometers

  • Analysis using specialized software (TopSpin, NMRPipe, NMRview, SPARKY)

• Computational modeling:

  • Iterative docking followed by flexible loop reconstruction using Rosetta

  • Refinement of structures in explicit membrane bilayers (DMPC)

  • Force field-based simulations (LIPID14, AMBER14)

• Electron Paramagnetic Resonance (EPR):

  • Four-pulse DEER (Double Electron-Electron Resonance) assays

  • Determines distances between spin labels on opposite ends of KCNE3 TMD

  • Analysis using specialized software (GLADD)

• Structural validation:

  • Satisfaction of experimental restraints

  • Quality assessment using metrics like MolProbity score

  • Deposit of validated structures to public databases (e.g., PDB accession code 2M9Z)

How does KCNE3 structure relate to its function in modulating potassium channels?

The structure-function relationship of KCNE3 provides insights into its modulatory mechanism:

• Structural basis for KCNQ1 modulation:

  • KCNE3 modulates KCNQ1 through removal of voltage-dependent gating

  • This creates a constitutively open leak channel essential for potassium recycling

• Key interaction sites:

  • KCNE3 Asp54/Asp55 with KCNQ1 Arg237

  • KCNE3 Asp90/Asp91 with KCNQ1 Ser338

• Allosteric coupling mechanisms:

  • Some energetic coupling between KCNE3 and KCNQ1 residues involves allosteric networks rather than direct contact

  • This is supported by the observation that some interacting residues in double-mutant cycle studies are not in direct contact in structural models

• Structural dynamics:

  • NMR data on protein dynamics (T₁, T₂, and ¹⁵N-(¹H)-NOE parameters)

  • Accessibility data from paramagnetic probes provides insights into membrane topology and dynamics

Understanding these structural elements provides a foundation for rational drug design targeting KCNE3-channel interactions in various pathologies.