KEL3 Antibody

Shipped with Ice Packs
In Stock

Description

Overview of the KEL3 Antigen

The KEL3 antigen, also designated Kp⁴, is part of the Kell blood group system encoded by the KEL gene on chromosome 7 (7q33). Key characteristics include:

  • Genetic basis: A single nucleotide polymorphism (SNP) at position 961C→T in exon 8 results in an arginine-to-tryptophan substitution (R281W) .

  • Protein structure: The Kell glycoprotein (CD238) is a 732-amino-acid transmembrane zinc-dependent endopeptidase. KEL3 is expressed on the extracellular domain, linked via disulfide bonds to the XK protein .

  • Antithetical pair: KEL3 (Kp⁴) and KEL4 (Kpᵇ) are codominant alleles, with KEL4 being far more prevalent globally .

Epidemiology of KEL3 Antigen

Global prevalence data for KEL3 (Kp⁴) are summarized below:

PopulationKEL3 FrequencySource
Caucasians~2%
BlacksRare (<0.1%)
Thais0% (homozygous KEL*04)
ArabsUp to 25%

Note: KEL3 is less common than other Kell antigens like KEL1 (K) and KEL2 (k) .

Clinical Significance of KEL3 Antibodies

KEL3 antibodies are primarily IgG and implicated in:

  • Hemolytic transfusion reactions (HTRs): Anti-KEL3 can cause intravascular or extravascular hemolysis upon exposure to KEL3-positive RBCs .

  • HDFN: Although less common than anti-KEL1, anti-KEL3 can suppress fetal erythropoiesis and cause severe anemia in neonates .

  • Complement interaction: Unlike other Kell antibodies, anti-KEL3 may accelerate antigen removal from RBC surfaces via complement-mediated modulation, reducing antigen availability for immune recognition .

Serological Testing

  • Column agglutination (CAT): Standard method using anti-Kp⁴ sera. False positives may occur in patients with autoimmune hemolytic anemia .

  • Flow cytometry: Detects antibody binding to KEL3-positive RBCs with high sensitivity .

Molecular Genotyping

  • PCR-SSP (sequence-specific priming): An in-house method developed for KEL03 allele detection uses primers targeting the 961C→T SNP :

TargetPrimer Sequence (5’→3’)Product Size
KEL03CCTTGTCAATCTCCATCACTTCAT158 bp
KEL04CCTTGTCAATCTCCATCACTTCAC158 bp

This method is cost-effective and avoids reliance on scarce antisera .

Immune Response Mechanisms

  • Complement regulation: Anti-KEL3 antibodies fix complement component C3d on RBCs, leading to accelerated antigen loss. This contrasts with microbial immune responses, where C3 enhances antibody formation .

  • T-cell independence: KEL3 antibodies can form without CD4⁺ T-cell help in certain contexts, though C3 deficiency shifts the response to T-cell dependence .

Therapeutic and Diagnostic Antibodies

  • Research antibodies: Commercial anti-KEL reagents (e.g., Miltenyi Biotec’s CD238-PE) detect Kell glycoproteins but are not KEL3-specific .

  • Clinical relevance: Anti-KEL3 is rare but necessitates precise RBC genotyping in transfusion-dependent patients to prevent alloimmunization .

Key Research Findings

  • Antigen modulation: KEL3 antibodies induce rapid clearance of KEL3-positive RBCs via complement-mediated antigen internalization .

  • Structural insights: Computational models suggest KEL3’s R281W mutation alters surface accessibility, increasing immunogenicity compared to KEL4 .

Global Health Implications

  • Transfusion policy: KEL3 typing is recommended for pregnant women and chronically transfused patients in high-prevalence regions .

  • Genotyping adoption: High-throughput sequencing is advocated to overcome serological limitations and improve donor-recipient matching .

Product Specs

Buffer
Preservative: 0.03% Proclin 300
Composition: 50% Glycerol, 0.01M Phosphate Buffered Saline (PBS), pH 7.4
Form
Liquid
Lead Time
Made-to-order (14-16 weeks)
Synonyms
KEL3 antibody; YPL263CKelch repeat-containing protein 3 antibody
Target Names
KEL3
Uniprot No.

Q&A

What is the Kell blood group system and how does KEL3 relate to other Kell antigens?

The Kell blood group system is one of the most complex blood group systems, comprising at least 35 antigens. The most immunogenic antigen in this system is K (KEL1), present in only about 9% of Caucasians and 2% of African-Americans. KEL3 (or Kpa) is another antigen in this system with lower frequency than KEL1. These antigens are carried on the Kell glycoprotein, a 732 amino acid transmembrane protein with a mass of 82.8 kDa that functions as a metalloendopeptidase. The Kell glycoprotein is predominantly expressed on erythrocyte membranes but is also found in testis (Sertoli cells), skeletal muscle, tonsils, lymph nodes, spleen, and appendix .

How do anti-KEL antibodies differ from other blood group antibodies in their clinical significance?

Anti-KEL antibodies, particularly anti-K (anti-KEL1), are exceptionally significant in transfusion medicine due to their high immunogenicity—second only to anti-D (Rh) antibodies among non-ABO blood group antigens. Unlike some blood group antibodies, anti-KEL antibodies (typically IgG) can cause both acute and delayed hemolytic transfusion reactions. What makes anti-KEL antibodies particularly noteworthy in the context of hemolytic disease of the fetus/newborn (HDFN) is their unique mechanism of action—they not only destroy circulating fetal red blood cells but also suppress erythropoiesis by attacking immature KEL-positive red cell precursors in the bone marrow. This dual action can lead to particularly severe fetal anemia .

What methodologies are most commonly used for detection of KEL3 antibodies in research settings?

For detection of anti-KEL antibodies in research settings, several techniques have demonstrated effectiveness:

  • Flow cytometry with conjugated anti-human antibodies (such as PE anti-human CD238/KEL)

  • Western blotting for protein expression analysis

  • Immunohistochemistry for tissue localization studies

  • ELISA for quantitative antibody detection

  • Indirect antiglobulin testing for antibody screening in serum samples

These methodologies vary in sensitivity and specificity, with flow cytometry offering high sensitivity for cell surface KEL detection, while Western blotting provides definitive identification of the KEL protein based on molecular weight .

How can I design experiments to evaluate anti-KEL3 antibody specificity across similar Kell system antigens?

Designing experiments to evaluate anti-KEL3 antibody specificity requires careful consideration of cross-reactivity with other Kell system antigens. A comprehensive approach includes:

  • Absorption and elution studies: Use red cells expressing single Kell antigens to absorb antibodies, followed by elution and testing against panels of cells with known Kell phenotypes.

  • Competitive binding assays: Employ labeled and unlabeled antibodies to different Kell antigens to assess competitive binding, providing insights into epitope relationships.

  • Recombinant antigen panels: Develop a panel of recombinant Kell protein variants expressing different combinations of Kell antigens to test antibody specificity.

  • Cross-blocking experiments: Use flow cytometry to determine whether binding of anti-KEL3 antibodies blocks binding of antibodies to other Kell system antigens, indicating spatial proximity or epitope overlap .

Recent computational approaches using AI-based technologies for analyzing antibody-antigen binding modes offer additional tools for understanding specificity profiles and potentially designing antibodies with customized specificity .

What are the key considerations for developing a murine model to study anti-KEL alloimmunization?

Developing a murine model to study anti-KEL alloimmunization requires careful attention to several key factors:

  • Transgenic expression system: Create transgenic mice expressing human KEL glycoprotein on murine RBCs. This typically involves using erythroid-specific promoters to drive expression of the human KEL gene.

  • Verification of antigen expression: Confirm expression of the KEL antigen on mouse RBCs using flow cytometry and Western blotting to ensure appropriate levels and conformation of the antigen.

  • Immunization protocol design: Establish protocols for primary and secondary immunization, considering route of administration (transfusion vs. injection), dose of antigen, and timing of exposure.

  • Immune response assessment: Develop reliable assays to measure antibody production, including ELISA, flow cytometry, and functional assays that assess the ability of antibodies to mediate clearance or destruction of KEL-expressing cells.

  • Genetic background considerations: Test the model in mice of different genetic backgrounds, as immunological responses can vary substantially between strains. Consider using knockout mice lacking specific immune components (like FcγRs or C3) to dissect mechanisms .

Research has demonstrated that murine models can be effective for studying immunoprophylaxis with anti-KEL sera and understanding mechanisms like antigen modulation, which may be relevant to human immunoprophylaxis strategies like Rh immune globulin .

How can computational methods be leveraged to predict and design anti-KEL antibody specificity?

Computational methods offer powerful approaches for predicting and designing anti-KEL antibody specificity:

  • Binding mode identification: Computational models can identify distinct binding modes associated with particular ligands, allowing disentanglement of these modes even for chemically similar epitopes.

  • Energy function optimization: By optimizing energy functions associated with specific binding modes, researchers can design antibodies with:

    • High specificity for a single ligand (by minimizing binding energy for the desired ligand while maximizing it for undesired ligands)

    • Cross-specificity for multiple ligands (by jointly minimizing binding energies for all desired ligands)

  • Machine learning approaches: Deep learning models trained on high-throughput sequencing data from phage display experiments can predict binding profiles of novel antibody sequences.

  • Structure-based modeling: When structural information is available, computational methods can identify key residues involved in antibody-antigen interactions and predict the impact of mutations.

Recent research has demonstrated success in designing antibodies with customized specificity profiles using these approaches, with experimental validation confirming the computational predictions .

What are the optimal conditions for detecting low-abundance KEL antigens in tissue samples?

Detecting low-abundance KEL antigens in tissue samples requires optimized protocols:

  • Sample preparation optimization:

    • Fresh-frozen tissues generally preserve antigenicity better than formalin-fixed, paraffin-embedded tissues

    • Antigen retrieval methods should be carefully optimized for KEL antibodies, with citrate buffer (pH 6.0) often providing good results

    • Blocking with 5% BSA in PBS with 0.1% Tween-20 helps reduce background

  • Signal amplification strategies:

    • Tyramide signal amplification can increase sensitivity by 10-100 fold

    • Polymer-based detection systems provide enhanced sensitivity over traditional avidin-biotin methods

    • Consider multiplexed immunofluorescence with spectral unmixing to distinguish true signal from autofluorescence

  • Antibody selection and validation:

    • Polyclonal antibodies may offer better sensitivity for tissue detection

    • Validation using positive and negative control tissues is essential

    • Careful titration of primary antibodies improves signal-to-noise ratio

For research applications requiring detection of KEL in tissues with low expression (such as lymph nodes or spleen), immunohistochemistry protocols may require extended primary antibody incubation (overnight at 4°C) and careful optimization of detection systems .

What strategies can minimize non-specific binding when using anti-KEL antibodies in flow cytometry?

Minimizing non-specific binding in flow cytometry applications with anti-KEL antibodies involves several key strategies:

  • Proper blocking protocol:

    • Use 2% normal serum from the same species as the secondary antibody

    • Include 0.5% BSA in all washing and incubation buffers

    • Consider adding 5-10% human AB serum when working with human samples to block Fc receptors

  • Antibody titration:

    • Perform careful titration experiments to determine optimal antibody concentration

    • Plot signal-to-noise ratio against antibody concentration to identify the optimal dilution

  • Compensation controls:

    • Use single-color controls for proper compensation when working with multiple fluorophores

    • Include fluorescence-minus-one (FMO) controls to set accurate gates

  • Dead cell exclusion:

    • Include viability dyes to exclude dead cells, which can bind antibodies non-specifically

    • Consider using Ghost Dyes or fixable viability dyes if fixation is required

For flow cytometry applications with PE anti-human CD238/KEL recombinant antibodies, optimal results are typically achieved with concentrations between 0.25-1.0 μg per million cells, with incubation at 4°C for 30 minutes followed by three washing steps .

How can I evaluate potential interference of anti-KEL antibodies with other laboratory assays?

Evaluating potential interference of anti-KEL antibodies with other laboratory assays requires a systematic approach:

  • Cross-reactivity testing:

    • Test the antibody against a panel of structurally related and unrelated proteins

    • Include proteins from the Peptidase M13 family to which KEL belongs

    • Perform Western blots on tissue lysates from multiple sources to identify unexpected bands

  • Absorption studies:

    • Pre-absorb antibodies with purified antigens or expressing cells

    • Compare results before and after absorption to identify non-specific binding

  • Competitive assays:

    • Perform competitive binding assays with known ligands of KEL

    • Test whether other endopeptidases compete for antibody binding

  • Functional interference assessment:

    • Evaluate whether antibody binding affects the endopeptidase activity of KEL

    • Test if antibody binding alters interactions with other proteins like XK and Kx

For research using anti-KEL antibodies in multiplex assays, it's particularly important to verify that the antibody doesn't interfere with other detection systems through unexpected interactions with secondary reagents or other primary antibodies in the panel .

What mechanisms might explain unexpected cross-reactivity of anti-KEL antibodies with non-KEL proteins?

Unexpected cross-reactivity of anti-KEL antibodies with non-KEL proteins can occur through several mechanisms:

  • Epitope homology:

    • Structural similarity between the target epitope on KEL and sequences on other proteins

    • Particularly likely with other metalloendopeptidases in the M13 family (like neprilysin or endothelin-converting enzymes)

  • Post-translational modifications:

    • Similar glycosylation patterns between KEL and other proteins

    • Shared phosphorylation or other modification sites that form part of the epitope

  • Conformational epitopes:

    • Three-dimensional structural similarity that isn't apparent from primary sequence

    • Antibodies recognizing conformational epitopes may bind to proteins with similar tertiary structure

  • Non-specific binding mechanisms:

    • Charge-based interactions, particularly with highly basic or acidic proteins

    • Hydrophobic interactions with exposed hydrophobic patches on denatured proteins

When unexpected cross-reactivity is observed, epitope mapping using techniques like hydrogen-deuterium exchange mass spectrometry or alanine scanning mutagenesis can help identify the specific regions involved in antibody binding and explain the molecular basis for cross-reactivity .

How can I determine if anti-KEL antibodies are affecting erythropoiesis in my experimental model?

Determining whether anti-KEL antibodies are affecting erythropoiesis requires a multi-faceted approach:

  • Bone marrow analysis:

    • Perform flow cytometry on bone marrow cells using markers for erythroid precursors (CD71, CD235a)

    • Quantify the proportion of cells at different stages of erythroid differentiation

    • Look for specific depletion of KEL-positive erythroid precursors

  • Colony formation assays:

    • Culture bone marrow cells in methylcellulose with erythropoietin

    • Compare BFU-E and CFU-E colony formation in the presence and absence of anti-KEL antibodies

    • Analyze colonies for KEL expression and maturation status

  • Reticulocyte analysis:

    • Measure reticulocyte percentage in peripheral blood

    • Evaluate reticulocyte maturation index

    • Track reticulocyte production over time after antibody administration

  • Erythropoietin response:

    • Measure serum erythropoietin levels

    • Assess phosphorylation of STAT5 in erythroid precursors as an indicator of EPO signaling

    • Evaluate whether exogenous EPO can overcome suppression

This approach is particularly important when studying anti-KEL antibodies in the context of HDFN models, as suppression of erythropoiesis rather than hemolysis may be the predominant mechanism of anemia .

What are the key considerations for using AI-based antibody design for developing novel anti-KEL antibodies?

AI-based antibody design for developing novel anti-KEL antibodies involves several critical considerations:

  • Training data quality and diversity:

    • Ensure training datasets include diverse antibody sequences with well-characterized binding properties

    • Incorporate structural information when available to improve prediction accuracy

    • Include negative examples (non-binders) to improve specificity predictions

  • Epitope definition and targeting:

    • Clearly define the target epitope on the KEL protein

    • Consider targeting regions unique to specific KEL antigens for improved specificity

    • Use structural modeling to predict accessibility of the epitope in native conformation

  • Validation strategy design:

    • Plan for experimental validation using multiple orthogonal techniques

    • Include binding affinity measurements, specificity profiling, and functional assays

    • Consider validation across different experimental systems (cell-based, purified protein)

  • Developability assessment:

    • Incorporate filters for parameters like stability, solubility, and aggregation propensity

    • Evaluate immunogenicity risk for novel sequences

    • Consider manufacturability characteristics

Recent advances in AI-based technology have demonstrated success in de novo generation of antigen-specific antibody CDRH3 sequences, which can be particularly valuable for developing antibodies with customized specificity profiles for KEL variants .

How can antigen modulation be leveraged as a mechanism in KEL immunoprophylaxis research?

Antigen modulation represents a potentially important mechanism in KEL immunoprophylaxis that can be leveraged in research:

  • Experimental approaches to study antigen modulation:

    • Flow cytometry to quantify KEL antigen density before and after antibody exposure

    • Western blotting to confirm actual reduction in KEL protein levels

    • Confocal microscopy to visualize antigen internalization or shedding

    • Pulse-chase experiments to track antigen fate after antibody binding

  • Mechanisms to investigate:

    • Antibody-mediated internalization of KEL antigen

    • Proteolytic cleavage and shedding of KEL from the cell surface

    • Masking of KEL epitopes without actual removal

    • Redistribution of KEL within the membrane

  • Experimental models:

    • Transgenic mice expressing human KEL on erythrocytes

    • In vitro culture systems with KEL-expressing cell lines

    • Ex vivo treatment of human KEL-positive red cells

Research has shown that in murine models, immunoprophylaxis with polyclonal anti-KEL sera prevents alloimmunization, and this protection occurs even in mice lacking Fcγ receptors or complement component C3 individually (but not in double-knockout mice lacking both). This suggests that antigen modulation may be an important mechanism in immunoprophylaxis, potentially relevant to understanding how treatments like Rh immune globulin prevent alloimmunization in humans .

How might single-cell technologies advance our understanding of anti-KEL antibody responses?

Single-cell technologies offer unprecedented opportunities to advance our understanding of anti-KEL antibody responses through several approaches:

  • Single-cell RNA sequencing of B cells:

    • Profile activated B cells after KEL antigen exposure to understand transcriptional programs

    • Track clonal evolution of KEL-specific B cells over time

    • Identify gene expression signatures associated with persistent vs. transient antibody responses

  • Single-cell BCR sequencing:

    • Reconstruct paired heavy and light chain sequences from KEL-specific B cells

    • Track somatic hypermutation patterns in response to different KEL antigens

    • Identify convergent antibody sequences across individuals with similar anti-KEL responses

  • Cellular indexing of transcriptomes and epitopes (CITE-seq):

    • Simultaneously profile surface protein expression and transcriptomes

    • Correlate KEL-binding capability with transcriptional state

    • Identify phenotypic markers of KEL-specific memory B cells

  • Spatial transcriptomics:

    • Map the distribution of KEL-specific B cells within lymphoid tissues

    • Understand spatial relationships between KEL-specific B cells and other immune cells

    • Identify tissue microenvironments supporting anti-KEL antibody production

These approaches could provide fundamental insights into why certain individuals are more prone to developing anti-KEL antibodies and might reveal novel targets for preventing alloimmunization .

What are the prospects for using CRISPR-Cas9 genome editing in KEL antibody research?

CRISPR-Cas9 genome editing offers exciting prospects for KEL antibody research:

  • Engineered cellular models:

    • Create isogenic cell lines with specific KEL variants to study epitope specificity

    • Generate knockout models to study KEL function and interaction with antibodies

    • Introduce patient-specific KEL mutations to study clinical phenotypes

  • Animal model development:

    • Generate humanized mouse models expressing human KEL variants

    • Create models with modified Fc receptor systems to study antibody effector functions

    • Develop reporter systems for monitoring KEL expression in vivo

  • Therapeutic applications:

    • Engineer B cells with receptors specific for KEL antigens

    • Modify hematopoietic stem cells to prevent KEL expression in patients requiring chronic transfusion

    • Create universal donor red cells by eliminating multiple immunogenic antigens including KEL

  • Mechanistic studies:

    • Introduce specific mutations in KEL to map critical residues for antibody binding

    • Modify cellular machinery involved in antigen presentation to understand immunogenicity

    • Alter signaling pathways to study cellular responses to anti-KEL antibody binding

These approaches could transform our understanding of KEL biology and open new avenues for preventing or treating KEL alloimmunization .

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.