KRT13 Antibody, Biotin conjugated

What is Cytokeratin 13 (KRT13) and what tissues express this protein?

Cytokeratin 13 (KRT13) is a type I acidic keratin with a molecular weight of approximately 50 kDa. It is predominantly expressed in the suprabasal layers of non-cornified stratified epithelia including tongue mucosa, esophagus, anal canal epithelium, tracheal epithelium, uterine cervix, and urothelium. KRT13 typically pairs with its basic partner, KRT4, and functions in maintaining cellular structural integrity. Mutations in the KRT13 gene are associated with white sponge nevus, an autosomal dominant disorder characterized by soft, white, spongy plaques in the oral mucosa .

What are the recommended experimental applications for biotin-conjugated KRT13 antibodies?

Biotin-conjugated KRT13 antibodies are validated for multiple applications with specific recommended dilutions:

Note: It is always recommended to titrate the antibody in each specific testing system to obtain optimal results .

What antigen retrieval methods are recommended for IHC when using KRT13 antibodies?

For optimal immunohistochemical detection, two antigen retrieval methods are recommended:

• Primary recommendation: TE buffer pH 9.0

• Alternative method: Citrate buffer pH 6.0

These recommendations are based on validation studies with human cervical cancer tissue and human esophageal tissue samples . The choice between these methods may depend on tissue type and fixation conditions.

How should I select appropriate positive controls for KRT13 antibody validation?

Based on validation data, the following are recommended positive controls for KRT13 antibody experiments:

Cell lines:

• A431 cells (strongly positive in WB, IP, IF/ICC, and FC)

• HaCaT cells (positive in IF/ICC)

• HeLa cells (validated for flow cytometry)

Tissue samples:

• Human cervical cancer tissue

• Human esophageal tissue/cancer

• Human tonsil

• Mouse/rat skin tissue

For negative controls, tissues known to lack KRT13 expression or using isotype-matched control antibodies are recommended . When establishing new experimental systems, it is advisable to include both positive and negative controls to ensure antibody specificity.

What are important considerations for fixation and preservation when using biotin-conjugated KRT13 antibodies?

The preservation of epitopes is critical for successful immunostaining with KRT13 antibodies. For optimal results:

• Formalin fixation: 10% neutral buffered formalin for 24-48 hours is standard

• Paraffin embedding: Process tissues according to standard histological protocols

• Section thickness: 4-5 μm sections are optimal for most applications

• Storage considerations: Store mounted sections at room temperature; refrigerate or freeze unused sections

• Deparaffinization: Complete removal of paraffin is essential before immunostaining

• Blocking endogenous biotin: When using biotin-conjugated antibodies, block endogenous biotin with avidin/biotin blocking kits

• Blocking endogenous peroxidase: Treatment with 3% H₂O₂ in distilled water for 15 minutes is recommended

How can KRT13 antibodies be used to investigate epithelial-to-mesenchymal transition (EMT) in cancer research?

KRT13 has emerged as an important marker in studying EMT processes in various cancers. Research findings indicate:

• In breast cancer studies, KRT13 overexpression induces EMT, with stronger staining observed at the extending edge of cell colonies compared to the center, correlating with the tumor invasive front in breast cancer tissue specimens .

• The KRT13 expression pattern in single cell colonies of MCF7-KRT13 cells showed an "edge-positive phenomenon" that correlates with invasion capacity, making it valuable for studying invasive behavior .

• Methodologically, researchers should consider dual immunostaining with KRT13 and established EMT markers (E-cadherin, vimentin) to evaluate correlation between KRT13 expression and EMT status.

• For quantitative analysis of KRT13 in EMT, the immunoreactivity scoring system (IRS) can be applied, calculated by multiplying the percentage of positive cells (0-4 scale) by staining intensity (0-3 scale), resulting in scores between 0-12 .

How does KRT13 expression correlate with tumor progression and metastasis in different cancer types?

KRT13 expression shows tissue-specific and cancer type-specific patterns that can be valuable in understanding tumor progression:

These findings suggest that KRT13 antibodies can be valuable tools for differential diagnosis between primary and metastatic tumors in certain contexts .

What is the mechanism by which KLF4 regulates KRT13 expression and how can this be studied?

Research has identified Krüppel-like factor 4 (KLF4) as a transcriptional regulator of KRT13:

• KLF4 induces differentiation of esophageal squamous cell carcinoma (ESCC) by promoting KRT13 transcription through binding to the GKRE (GC-rich KLF4 responsive element) in the KRT13 promoter .

• Methodological approach to study this mechanism:

  • Chromatin immunoprecipitation (ChIP) assays using primers for the GKRE region:

    • Forward: CGAACCAAGCAAAGTTTGTCATC

    • Reverse: ACCCAGTATTAGAACGGGACCT

  • Luciferase reporter assays using KRT13 promoter constructs (512 bp):

    • Forward: TCGGGGTACCGGATCCAGGACATCCCAG

    • Reverse: GCCGCTCGAGTGGTGAGAGCAGGATTGAG

  • Site-directed mutagenesis of the GKRE to confirm specificity

• This KLF4-KRT13 regulatory axis represents a significant pathway in epithelial differentiation and cancer progression that can be explored using KRT13 antibodies.

How can I address non-specific binding when using biotin-conjugated KRT13 antibodies?

Non-specific binding is a common challenge with biotin-conjugated antibodies. To minimize this issue:

• Block endogenous biotin using commercial avidin/biotin blocking kits before applying the primary antibody

• Include adequate blocking steps (3% horse serum in PBS is recommended in several protocols)

• Optimize antibody dilution - test a range of dilutions to determine the optimal concentration

• Include proper negative controls (isotype controls and tissue known to be KRT13-negative)

• For antigen retrieval, follow the recommended protocol using TE buffer pH 9.0 or citrate buffer pH 6.0

• If background persists, try increasing washing steps duration and/or adding 0.1% Tween-20 to wash buffers

• For flow cytometry applications, ensure proper cell permeabilization as KRT13 is an intracellular protein

What factors should be considered when evaluating discrepancies in KRT13 staining patterns across different studies?

When encountering inconsistent KRT13 staining patterns in the literature or between experiments, consider these factors:

• Antibody clone variability: Different clones may recognize different epitopes of KRT13

  • Monoclonal vs. polyclonal: One study noted higher detection rates with polyclonal antibodies (possibly due to recognition of multiple epitopes)

  • Clone specificity: EPR3671 is noted as the most widely used clone for KRT13

• Technical variations:

  • Fixation methods and duration

  • Antigen retrieval techniques

  • Detection systems (direct vs. indirect; chromogenic vs. fluorescent)

  • Scoring systems used (simple positive/negative vs. IRS scoring)

• Biological variables:

  • Tumor heterogeneity and differentiation status

  • KRT13 expression varies by differentiation grade in some cancers

  • KRT13 shows dynamic expression during differentiation (e.g., KRT13(low)/KRT14(high) to KRT13(high)/KRT14(low) switch)

• Quantification methodology: IRS scores ≥3.5 are typically considered positive, but thresholds vary between studies

How can KRT13 antibodies be utilized in exploring the role of cellular stress responses in epithelial tissues?

KRT13 has been implicated in cellular stress responses, particularly in mechanical stress response pathways:

• KRT13 maintains postnatal tongue mucosal cell homeostasis and tissue organization in response to mechanical stress, potentially via regulation of the G1/S phase cyclins CCNE1 and CCNE2 .

• Research approaches to explore this function:

  • In vitro mechanical stress models (stretching, compression)

  • Correlation of KRT13 expression with cell cycle regulators (CCNE1, CCNE2)

  • Live cell imaging with fluorescently tagged KRT13 to observe dynamic responses

  • Co-immunoprecipitation studies to identify stress-induced protein interactions

• This research direction could provide insights into epithelial adaptation to environmental stresses and has implications for understanding conditions like white sponge nevus, where KRT13 mutations alter epithelial responses to mechanical forces.

What are emerging applications of KRT13 antibodies in single-cell analysis techniques?

Single-cell analysis techniques represent a frontier in KRT13 research with several promising applications:

• Single-cell RNA-seq combined with KRT13 protein detection can help map heterogeneity in epithelial tissues and tumors

  • This approach can identify subpopulations with distinctive KRT13 expression patterns

  • Correlation with stemness markers (as seen in breast cancer studies) can reveal cellular hierarchies

• Mass cytometry (CyTOF) applications using metal-conjugated KRT13 antibodies enable simultaneous detection of multiple markers

  • This allows comprehensive phenotyping of KRT13+ cells in complex tissues

  • Can be combined with signaling markers to assess pathway activation

• Spatial transcriptomics combined with KRT13 immunostaining permits correlation of KRT13 protein expression with local transcriptional profiles

  • This is particularly relevant given the "edge-positive phenomenon" observed in cancer cell colonies

  • May reveal spatial regulation of KRT13 expression in relationship to the tumor microenvironment

• Methodological considerations for these applications include tissue preservation techniques that maintain both RNA integrity and protein antigenicity, as well as optimization of multiplexed antibody panels.

What is the potential of using KRT13 as a biomarker in liquid biopsy approaches?

While traditional KRT13 detection relies on tissue samples, emerging research suggests potential applications in liquid biopsy:

• Circulating tumor cells (CTCs) from epithelial cancers may express KRT13, particularly those derived from tissues where KRT13 is normally expressed

• Extracellular vesicles (EVs) containing KRT13 protein or mRNA could be detected in patient biofluids

  • Isolation protocols would need to be optimized for KRT13 detection

  • Western blotting, ELISA, or PCR-based methods could be employed for detection

• Cell-free DNA methylation analysis of the KRT13 promoter region could provide insights into KRT13 regulation status

  • The interaction between KLF4 and the KRT13 promoter suggests potential epigenetic regulation

• These approaches would require validation against tissue-based detection methods and careful consideration of sensitivity and specificity parameters for clinical applications.

How should KRT13 immunostaining patterns be interpreted in differentiation studies of stratified epithelia?

Interpretation of KRT13 staining patterns in differentiation studies requires understanding of normal expression patterns:

• In normal stratified non-cornified epithelia:

  • KRT13 expression is typically absent in basal layers

  • Expression increases in suprabasal (differentiating) layers

  • Often co-expressed with KRT4 as its basic partner

• During differentiation:

  • A switch from KRT13(low)/KRT14(high) to KRT13(high)/KRT14(low) phenotype is observed when transitional cell morphology is acquired

  • This can be used to track differentiation status in tissue engineering and organoid models

• Scoring recommendation:

  • Evaluate both percentage of positive cells and staining intensity

  • Document layer-specific expression patterns

  • Consider co-staining with other differentiation markers (KRT4, KRT14, involucrin)

  • Compare with appropriate positive controls (e.g., normal esophageal epithelium)

• Aberrant patterns may indicate pathological processes:

  • Loss of layer-specific expression can suggest dysplasia

  • Complete loss often indicates malignant transformation

  • Heterogeneous expression may reflect tumor differentiation status

How do I analyze contradictory findings regarding KRT13 expression in smoking-associated studies?

Analysis of smoking-related KRT13 expression presents an interesting case of potentially contradictory findings:

• Resolving apparent contradictions:

  • Consider sample size effects (smaller subgroups may show different patterns)

  • Tissue specificity (smoking effects may vary across epithelial tissues)

  • Differentiate between tumor and normal tissue responses

  • Consider multi-factorial analysis including other variables (tumor grade, stage, etc.)

  • Evaluate methodological differences between studies

• Recommendations for future smoking-related studies:

  • Include larger sample sizes

  • Perform matched normal/tumor analysis where possible

  • Consider duration and intensity of smoking exposure

  • Include former smokers as a separate category

  • Control for confounding variables