KRT71 Antibody

What is KRT71 and what is its biological significance?

KRT71 (Keratin 71) belongs to a family of type II keratins that are specifically expressed in the inner root sheath (IRS) of hair follicles. It plays a central role in hair formation as an essential component of keratin intermediate filaments . KRT71 is mapped on human chromosome 12q13 and has a molecular weight of approximately 57 kDa as observed in experimental analyses . Mutations in the KRT71 gene have been reported to underlie hypotrichosis simplex (HS) and woolly hair (WH), which are rare monogenic disorders of hair loss . The biological significance of KRT71 lies in its critical function in maintaining proper hair structure and development through the formation of keratin intermediate filament networks with other keratin proteins.

What model systems are available for studying KRT71 function?

The primary model system described in the search results is a CRISPR/Cas9-generated Krt71-knockout mouse model. This model was created by co-injecting Cas9 mRNA and sgRNA targeting exon 6 of the mouse Krt71 gene into mouse zygotes . The knockout mice displayed phenotypes that closely mimic human hair disorders, including:

• Curly fur phenotype throughout the body, including beard hair

• Complete shedding of hair at 3-5 weeks of age, resembling nude mice

• Significantly shorter whisker length compared to wild-type mice

• Altered expression of related keratin family genes

This model demonstrates high knockout efficiency (83.3% of newborn pups carried Krt71 mutations) and no significant off-target effects at the most likely potential off-target sites . The model maintains normal survival rates and body weights comparable to wild-type mice, making it valuable for long-term studies of hair development and disorders .

What antibody applications are validated for KRT71 detection?

Several applications for KRT71 antibody have been validated according to the search results:

It should be noted that optimal dilutions may vary depending on the specific experimental conditions and sample types. Researchers are advised to perform titration experiments to determine the optimal antibody concentration for their specific testing system . The antibodies discussed in the search results show reactivity with human and mouse KRT71, with some cross-reactivity with rat KRT71 .

How does KRT71 knockout affect other hair-related genes?

KRT71 knockout has significant effects on multiple related genes involved in hair follicle development. The comprehensive analysis of Krt71-KO mice revealed both downregulation and upregulation of various genes:

Downregulated genes (paralog genes to KRT71):

• Krt25, Krt27: Located on human chromosome 17q12, encoding type I (acidic) keratin family members

• Krt72, Krt75, Krt85: Located on human chromosome 12q13 (same as Krt71)

These genes participate in the formation of keratin intermediate filaments in the inner root sheath and are related to Woolly Hair and Hypotrichosis conditions .

Upregulated genes:

• MZF1: A transcription factor that negatively regulates Krt71 gene expression by binding to the Krt71 promoter. In Krt71-KO mice, MZF1 expression increased by nearly 30-fold

• LPAR6: Highly expressed in hair follicles, especially the inner root sheath, and is associated with Hypotrichosis 8 and Familial Woolly Hair Syndrome. LPAR6 expression was significantly improved in Krt71-KO mice

• TGF-α: Increased dramatically to approximately 6-fold in Krt71-KO mice

These expression changes suggest a complex regulatory network and potential compensatory mechanisms activated when Krt71 is knocked out. The study authors speculated that an "unknown compensation mechanism was inevitable in the process of hair development" .

What are the optimal sample preparation protocols for Western blot detection of KRT71?

Based on the methodologies described in the research article and antibody product information, the following protocol recommendations can be made for Western blot detection of KRT71:

• Tissue collection and protein extraction:

  • Collect skin tissue samples from the experimental subjects (preferably fresh samples)

  • Homogenize the tissues in PBS buffer containing protease inhibitor cocktail

  • Determine protein concentration using a BCA protein quantification kit

• Sample preparation and loading:

  • Suspend approximately 30 μg of total protein in SDS sample buffer

  • Heat the samples at 95°C for 5 minutes (standard denaturation, though specific temperature not mentioned in search results)

  • Load samples onto SDS-PAGE gel (percentage not specified, but likely 10-12% based on the 57 kDa size of KRT71)

• Antibody incubation:

  • Primary antibody: Use anti-KRT71 antibody at a dilution of 1:500-1:2000 (or 0.01-2 μg/ml)

  • Incubate overnight at 4°C or according to laboratory standard protocols

  • Secondary antibody: Use appropriate HRP-conjugated secondary antibody (e.g., 1:2000 dilution)

  • Include GAPDH (1:2000) or similar housekeeping protein antibody as internal control

• Detection:

  • Visualize protein bands using an ECL reagent

  • For quantification, normalize the KRT71 signal to GAPDH or other appropriate housekeeping protein

Storage conditions for the antibody are also critical: store at -20°C and avoid repeated freeze/thaw cycles. The antibodies are typically provided in PBS with 0.02% sodium azide and 50% glycerol at pH 7.3 .

How can researchers verify knockout efficiency in CRISPR/Cas9-generated KRT71 models?

Based on the methodology described in the research article, verification of KRT71 knockout efficiency should follow a multi-level approach:

• Genomic DNA verification:

  • Extract genomic DNA from a small piece of tissue (e.g., toe) using a genomic DNA kit

  • Amplify the sgRNA target site by PCR using specific primers (Forward: 5′–GTATGAGGAGATTGCCCTGAAG–3′; Reverse: 5′–AGAGTGAGTAGAGAGGGAAGTG–3′)

  • Clone the PCR products into a suitable vector (e.g., pGM−T vector)

  • Sequence the clones and analyze the results to identify mutations

• mRNA expression analysis:

  • Extract total RNA from skin samples using an appropriate RNA extraction reagent

  • Synthesize first-strand cDNA using a cDNA synthesis kit

  • Perform both RT-PCR and quantitative RT-PCR (qRT-PCR) to examine Krt71 expression

  • Use GAPDH or another housekeeping gene for normalization

  • Calculate relative expression using the 2^(-ΔΔCT) formula

• Protein expression verification:

  • Perform Western blotting as described in question 2.2

  • Use specific anti-KRT71 antibody to detect protein levels

  • Compare protein levels between knockout and wild-type samples to confirm absence or significant reduction of KRT71 protein

• Phenotypic verification:

  • Observe and document hair phenotypes (e.g., curly hair, hair loss)

  • Measure and count hair characteristics (e.g., whisker length and quantity)

  • Perform histological analysis through H&E staining of skin sections

  • Use scanning electron microscopy to examine hair structure in detail

This comprehensive verification approach ensures that the knockout is confirmed at DNA, RNA, protein, and phenotypic levels, providing strong evidence for the success and specificity of the genetic modification.

What histological changes are observed in KRT71-deficient hair follicles?

The research article describes several histological changes observed in Krt71-knockout mice compared to wild-type mice. H&E staining of skin sections from 3-month-old mice revealed notable structural differences in hair follicles and related tissues . While the search results don't provide detailed descriptions or images of the histological findings, the article mentions that histological analysis was performed to examine the hair follicle structure.

Additionally, scanning electron microscopy was used to examine hair structure in detail, particularly focusing on beard hair from Krt71-KO and wild-type mice . The study found that whiskers from Krt71-KO mice were significantly shorter than those from wild-type mice. Approximately 86.7% of whiskers in Krt71-KO mice were less than 15 cm in length, while 60% of whiskers in wild-type mice were greater than 15 cm in length .

This suggests that KRT71 deficiency affects not only the curliness of hair but also its growth potential and possibly the internal structure of hair follicles, which would be visible in histological preparations.

What are common issues with KRT71 antibody specificity and how can they be addressed?

While the search results don't directly address antibody specificity issues, several recommendations can be inferred from the antibody product information and research methodology:

• Cross-reactivity concerns:

  • The antibodies mentioned show reactivity with human and mouse KRT71, with some cross-reactivity with rat KRT71

  • To address potential cross-reactivity with other keratin family members (which share structural similarities), researchers should validate antibody specificity using:

    • Positive controls (known KRT71-expressing tissues like skin)

    • Negative controls (KRT71 knockout tissues or cells where available)

    • Blocking peptide experiments to confirm specificity

• Optimal antibody selection:

  • Use antibodies that have been affinity-purified specifically for KRT71

  • The search results mention antibodies purified by "antigen-specific affinity chromatography, followed by Protein A affinity chromatography" or "antigen affinity purification"

  • Choose antibodies raised against immunogens that represent unique regions of KRT71 to minimize cross-reactivity with other keratins

• Validation methods:

  • Perform antibody validation using multiple techniques (WB, IHC, IF/ICC) to confirm consistent results

  • Use appropriate controls in each experiment, including isotype controls

  • Consider using multiple antibodies targeting different epitopes of KRT71 for confirmation

• Application-specific optimization:

  • For Western blotting: Optimize blocking, antibody concentration, and washing steps

  • For IHC/IF: Test different fixation methods and antigen retrieval protocols to maximize signal-to-noise ratio

  • "It is recommended that this reagent should be titrated in each testing system to obtain optimal results"

How can researchers properly design experiments to study KRT71-related hair disorders?

Based on the research article and antibody information, a comprehensive experimental design for studying KRT71-related hair disorders should consider:

• Model selection:

  • CRISPR/Cas9-generated Krt71-knockout mice provide a valuable model that mimics woolly hair and hypotrichosis

  • Consider the developmental timeline of phenotypes (curly hair appears first, followed by complete hair loss at 3-5 weeks)

  • Ensure ethical compliance (e.g., "All experiments involving mice in this study were performed in accordance with the guide of the Animal Care and Use Committee")

• Multi-omics approach:

  • Genomic analysis: Sequence KRT71 and related genes to identify mutations

  • Transcriptomic analysis: Examine expression changes in keratin family genes and other hair-related genes

  • Proteomic analysis: Study protein levels and interactions

  • Phenotypic analysis: Detailed characterization of hair morphology and growth patterns

• Temporal considerations:

  • Collect data at multiple time points to capture developmental changes

  • The study noted phenotype progression from curly hair to complete hair loss

  • Include age-matched controls for all experiments

• Molecular pathway analysis:

  • Study interactions between KRT71 and other keratin proteins

  • Investigate regulatory factors (e.g., MZF1 transcription factor)

  • Explore signaling pathways (e.g., TGF-α signaling) that may be affected by KRT71 deficiency

• Experimental controls:

  • Include wild-type controls for all experiments

  • Consider heterozygous models to study gene dosage effects

  • Use appropriate tissue-specific controls for expression studies

• Translational relevance:

  • Compare findings from animal models to human KRT71-related disorders

  • Consider therapeutic implications of the molecular mechanisms identified

How can KRT71 antibodies be used to study hair follicle development?

KRT71 antibodies represent powerful tools for investigating hair follicle development through various applications:

• Expression profiling:

  • Track KRT71 expression during different stages of hair follicle development

  • Use immunohistochemistry or immunofluorescence with KRT71 antibodies on tissue sections to visualize expression patterns

  • Compare expression in different hair types and across different body regions

• Co-localization studies:

  • Combine KRT71 antibodies with antibodies against other hair follicle proteins

  • Determine the precise cellular localization of KRT71 within the inner root sheath

  • Study potential interactions with other keratin family members

• Developmental time-course studies:

  • Examine KRT71 expression at different embryonic and postnatal stages

  • Correlate KRT71 expression with specific events in hair follicle morphogenesis

  • Study the relationship between KRT71 expression and hair cycling

• Pathological investigations:

  • Compare KRT71 expression and localization in normal versus diseased hair follicles

  • Use KRT71 as a marker for inner root sheath integrity in various hair disorders

  • Investigate changes in KRT71 expression in response to treatments or interventions

• 3D reconstruction:

  • Use confocal microscopy with KRT71 antibodies to create three-dimensional maps of expression

  • Develop a better understanding of the spatial organization of KRT71 within hair follicle structures

These applications can provide valuable insights into the normal development of hair follicles and the pathogenesis of hair disorders, potentially leading to new therapeutic approaches for conditions like hypotrichosis and woolly hair.

What are emerging techniques for studying KRT71 function beyond traditional antibody applications?

While the search results focus primarily on traditional antibody applications and knockout models, several emerging techniques could enhance the study of KRT71 function:

• Advanced genetic engineering approaches:

  • CRISPR/Cas9 has already proven valuable for creating knockout models

  • Consider more sophisticated CRISPR applications:

    • Conditional/inducible knockouts to study temporal aspects of KRT71 function

    • Knockin models with fluorescent tags to visualize KRT71 in living tissues

    • Base editing or prime editing for introducing specific disease-relevant mutations

• Single-cell technologies:

  • Single-cell RNA sequencing to identify cell populations expressing KRT71

  • Spatial transcriptomics to map KRT71 expression in the context of tissue architecture

  • CyTOF or single-cell proteomics to examine KRT71 protein expression at single-cell resolution

• Organoid and 3D culture systems:

  • Hair follicle organoids to study KRT71 function in a controlled environment

  • 3D bioprinting of hair follicle structures with modified KRT71 expression

  • Co-culture systems to examine interactions between different cell types in hair follicles

• Live imaging techniques:

  • In vivo imaging of fluorescently tagged KRT71 during hair follicle development

  • Intravital microscopy to observe hair follicle dynamics in living animals

  • Super-resolution microscopy for detailed visualization of keratin filament organization

• High-throughput screening approaches:

  • CRISPR screens to identify genes that interact with KRT71

  • Small molecule screens to identify compounds that modify KRT71 expression or function

  • Protein-protein interaction screens to map the KRT71 interactome

These advanced techniques could provide new insights into KRT71 function beyond what can be learned from traditional antibody-based approaches or simple knockout models, potentially revealing new therapeutic targets for hair disorders.