LHT2 Antibody

What is LHX2 and why is it significant as a research target?

LHX2 is a transcription factor belonging to the LIM homeobox gene family that plays a crucial role in numerous tumors. It has garnered significant research interest due to its upregulation in breast cancer tissues and its positive correlation with breast cancer progression. Studies indicate that LHX2 promotes cell proliferation, colony formation, migration, and invasion of breast cancer cells, while simultaneously inhibiting apoptosis .

As a potential biomarker, LHX2 expression shows strong correlation with clinical characteristics of breast cancer. Research has demonstrated that it activates the T-cell activation pathway, PI3K/AKT/mTOR signaling pathway, and influences the apoptosis pathway. These functional roles make LHX2 an important target for antibody-based research techniques in cancer biology .

How do researchers validate LHX2 antibody specificity?

Validating LHX2 antibody specificity involves several complementary approaches:

• Western blot validation: Researchers should first confirm the expected molecular weight of LHX2 protein bands using positive and negative control samples.

• Genetic validation: Testing the antibody in LHX2 knockout/knockdown cells compared to wild-type controls provides the most rigorous validation.

• Immunohistochemistry (IHC) controls: Include known positive and negative tissue controls, along with isotype controls to assess non-specific binding.

• Cross-reactivity testing: Evaluate potential cross-reactivity with other LIM domain-containing proteins to ensure specificity.

• Peptide competition assays: Pre-incubation of the antibody with blocking peptides containing the target epitope should abolish specific staining.

When reporting validation results, researchers should document detailed antibody information, including clone number, lot number, and dilutions used, as these factors may affect specificity and reproducibility .

What are the common applications of LHX2 antibodies in cancer research?

LHX2 antibodies serve multiple crucial functions in cancer research:

• Immunohistochemistry (IHC): To evaluate LHX2 protein expression levels and localization patterns in tumor tissue sections, helping correlate expression with clinicopathological features .

• Immunofluorescence: Used to investigate LHX2-related immune infiltration in breast cancer tissues, particularly for co-localization studies with immune cell markers .

• Western blotting: For quantitative assessment of LHX2 protein expression and activation of downstream signaling pathways, particularly the PI3K/AKT/mTOR pathway .

• Chromatin immunoprecipitation (ChIP): To identify genomic binding sites of LHX2 as a transcription factor, helping elucidate gene regulatory networks.

• Flow cytometry: For analyzing LHX2 expression in specific cell populations, especially when studying heterogeneous tumor samples.

These techniques collectively provide comprehensive insights into LHX2's role in cancer progression and immune modulation .

How can researchers optimize LHX2 antibody specificity for discriminating between similar epitopes?

Optimizing LHX2 antibody specificity for discriminating between similar epitopes requires a systematic approach:

• Biophysics-informed modeling: Recent advances combine experimental selection data with computational models to disentangle multiple binding modes associated with specific ligands. This approach helps identify antibody variants with customized specificity profiles that can discriminate between chemically similar epitopes .

• Selection strategy optimization: Rather than relying solely on traditional selection methods, implement a high-throughput sequencing approach followed by computational analysis to gain additional control over specificity profiles .

• Binding mode identification: Apply models that associate distinct binding modes with potential ligands, enabling the prediction and generation of specific variants beyond those observed in experiments .

• Systematic CDR variation: Focus on complementarity-determining regions (CDRs), particularly CDR3, which plays a crucial role in determining antibody specificity. Systematic variation of amino acids in these regions can yield antibodies with enhanced discrimination capabilities .

• Cross-reactivity assessment: Thoroughly test antibody candidates against a panel of structurally similar proteins to confirm specificity for LHX2 over related LIM domain proteins.

For optimal results, combine experimental phage display selections against diverse combinations of closely related ligands with computational modeling to generate antibody variants with desired specificity profiles .

What methodological approaches should be used to study LHX2's role in immune infiltration?

Studying LHX2's role in immune infiltration requires a multi-faceted methodological approach:

• Multiplex immunofluorescence imaging:

  • Combine LHX2 antibody staining with markers for different immune cell populations (T cells, CD4+ T cells, etc.)

  • Use spectral unmixing to distinguish multiple fluorescent signals

  • Apply tissue clearing techniques for 3D visualization of immune infiltration patterns

• Single-cell analytical techniques:

  • Single-cell RNA sequencing to correlate LHX2 expression with immune cell signatures

  • CyTOF (mass cytometry) for high-dimensional analysis of immune populations in relation to LHX2 status

• Spatial transcriptomics:

  • Integrate antibody-based protein detection with spatial RNA expression analysis

  • Map LHX2 expression patterns in relation to immune microenvironments within tumor tissues

• Functional assessment:

  • Use ssGSEA (single sample Gene Set Enrichment Analysis) to analyze correlations between LHX2 expression and specific immune cell populations, particularly Th1 and Th2 cells

  • Conduct in vitro co-culture experiments with LHX2-manipulated cancer cells and immune cells

• In vivo models:

  • Develop humanized mouse models to study immune infiltration in LHX2-expressing tumors

  • Compare immune infiltration patterns in LHX2-overexpressing vs. LHX2-knockdown tumors

These approaches collectively provide comprehensive insights into how LHX2 influences the tumor immune microenvironment, particularly in breast cancer contexts .

How do temporal dynamics affect LHX2 antibody-based measurements in longitudinal studies?

When conducting longitudinal studies using LHX2 antibodies, researchers must account for several factors affecting temporal dynamics:

• Antibody half-life considerations:

  • Circulating antibodies typically have half-lives ranging from 1-4 weeks, necessitating mathematical modeling to interpret fluctuations in measurements over time

  • The rate of antibody clearance (r) determines the time to plateau, which is a critical consideration for experimental design

• Production and clearance kinetics:

  • Antibody production often follows a biphasic pattern with an initial high rate followed by a lower rate

  • Any fall from peak levels must reflect a corresponding decrease in production rate

  • Mathematical modeling using equations like: Ab(t) = (AbPr1/r)(1-e^(-rt)) for t≤t_stop can help predict these dynamics

• Sampling frequency considerations:

  • High-frequency serial sampling (weekly or biweekly) is essential to accurately capture the dynamic changes in antibody levels

  • Single timepoint measurements may lead to misinterpretation of LHX2's biological significance

• Interpretation challenges:

  • Inter-individual heterogeneity in antibody responses requires testing associations with clinical and demographic variables

  • Semi-quantitative assays like ELISA should be calibrated to approximate a linear relationship with antibody levels across their dynamic range

To account for these temporal dynamics, researchers should implement statistical approaches including Spearman's rank correlation coefficients for paired assay values across the study period and linear regression models to assess variables affecting peak antibody levels .

What is the recommended protocol for LHX2 antibody-based immunohistochemistry in breast cancer tissues?

Recommended Protocol for LHX2 Immunohistochemistry in Breast Cancer Tissues:

• Tissue Preparation:

  • Fix tissues in 10% neutral buffered formalin for 24-48 hours

  • Process and embed in paraffin

  • Section at 4-5μm thickness onto positively charged slides

  • Include known LHX2-positive breast cancer tissue as a positive control

• Antigen Retrieval:

  • Deparaffinize sections in xylene and rehydrate through graded alcohols

  • Perform heat-induced epitope retrieval in citrate buffer (pH 6.0) at 95-98°C for 20 minutes

  • Allow slides to cool at room temperature for 20 minutes

• Staining Procedure:

  • Block endogenous peroxidase with 3% hydrogen peroxide for 10 minutes

  • Apply protein block (serum-free) for 15 minutes

  • Incubate with primary LHX2 antibody at optimized dilution (typically 1:100 to 1:500) overnight at 4°C

  • Apply appropriate HRP-conjugated secondary antibody for 30 minutes at room temperature

  • Develop with DAB substrate for 5-10 minutes and counterstain with hematoxylin

• Controls and Validation:

  • Include negative controls (primary antibody omitted)

  • Include isotype controls to assess non-specific binding

  • Validate staining pattern with known LHX2 expression patterns (nuclear localization expected)

• Evaluation:

  • Score LHX2 expression based on staining intensity (0-3+) and percentage of positive cells

  • Calculate H-score = ∑(intensity × percentage) ranging from 0-300

  • Correlate with clinicopathological features and immune infiltration markers

This protocol has been validated in studies investigating LHX2-related immune infiltration in breast cancer tissues and can be modified based on specific antibody manufacturer recommendations .

How should researchers design experiments to investigate LHX2's relationship with immune cell infiltration?

Experimental Design for Investigating LHX2-Immune Cell Infiltration Relationships:

• Patient Cohort Selection:

  • Include diverse breast cancer subtypes (luminal A/B, HER2+, triple-negative)

  • Collect comprehensive clinical data including treatment history and outcome measures

  • Obtain appropriate ethical approvals and informed consent

• Tissue Analysis Workflow:

  • Sequential Multiplex Immunofluorescence:

    • Panel 1: LHX2 + CD3 (T cells) + CD4 (helper T cells) + DAPI

    • Panel 2: LHX2 + CD8 (cytotoxic T cells) + FOXP3 (regulatory T cells) + DAPI

    • Panel 3: LHX2 + CD68 (macrophages) + CD163 (M2 macrophages) + DAPI

• Data Collection and Quantification:

  • Capture whole-slide images using multispectral imaging systems

  • Analyze using automated cell counting software to quantify:

    • LHX2+ tumor cells per mm²

    • Immune cell densities per mm² (tumor center and invasive margin)

    • Co-localization patterns and spatial relationships

• Correlation Analysis:

  • Correlate LHX2 expression levels with:

    • Densities of different immune cell populations

    • Expression of immune checkpoint molecules

    • Clinical outcomes and treatment responses

• Functional Validation Studies:

  • In vitro co-culture experiments:

    • Co-culture LHX2-overexpressing or LHX2-knockdown breast cancer cells with peripheral blood mononuclear cells

    • Measure T cell activation markers, proliferation, and cytokine production

  • Pathway analysis:

    • Assess PI3K/AKT/mTOR pathway activation in relation to immune infiltration

    • Use Western blot to measure phosphorylation of pathway components

• Single-cell RNA Sequencing:

  • Perform scRNA-seq on dissociated tumor samples with varying LHX2 expression

  • Identify gene expression signatures associated with immune cell recruitment

  • Validate findings using GO enrichment analysis and GSEA

This comprehensive experimental approach enables researchers to establish mechanistic links between LHX2 expression and immune infiltration in breast cancer, advancing our understanding of LHX2's role as an immune infiltration biomarker .

What quantitative PCR methods are most appropriate for analyzing LHX2 expression in breast cancer research?

Optimized qPCR Methods for LHX2 Expression Analysis in Breast Cancer Research:

• RNA Extraction Protocol:

  • For cell lines: Use TRIzol reagent (Invitrogen, Carlsbad, CA, USA) following manufacturer's protocol

  • For FFPE tissues: Use specialized kits designed for degraded RNA from fixed tissues

  • For fresh/frozen tissues: Homogenize in RLT buffer with β-mercaptoethanol

• cDNA Synthesis:

  • Reverse transcribe 1μg of total RNA using HiScript II Reverse Transcriptase (Vazyme, Nanjing, China)

  • Include RT-negative controls to detect genomic DNA contamination

  • Use random hexamers combined with oligo-dT primers for optimal coverage

• qPCR Reaction Setup:

  • Use Hieff® qPCR SYBR Green Master Mix (Yishen, Shanghai, China) or equivalent

  • Prepare 20μL reactions containing:

    • 10μL SYBR Green Master Mix

    • 0.4μL each of forward and reverse primers (10μM)

    • 2μL cDNA template

    • 7.2μL nuclease-free water

  • Run all samples in triplicate to ensure technical reproducibility

• Primer Design for LHX2:

  Target	Forward Primer (5'→3')	Reverse Primer (5'→3')	Amplicon Size
  LHX2	CAAGATCTCGGACCGCTACT	CCGTGTTCTCCTTCTTGGAC	121 bp
  GAPDH	GAAGGTGAAGGTCGGAGTC	GAAGATGGTGATGGGATTTC	226 bp

• Thermal Cycling Conditions:

  • Initial denaturation: 95°C for 5 minutes

  • 40 cycles of:

    • Denaturation: 95°C for 10 seconds

    • Annealing/Extension: 60°C for 30 seconds

  • Melt curve analysis: 65°C to 95°C in 0.5°C increments

• Data Analysis:

  • Use the 2^(-ΔΔCt) method for relative quantification

  • Normalize LHX2 expression to GAPDH as the reference gene

  • Include inter-run calibrators for experiments spanning multiple plates

  • Validate reference gene stability across experimental conditions

• Quality Control Measures:

  • Determine PCR efficiency using standard curves (acceptable range: 90-110%)

  • Verify primer specificity through melt curve analysis and gel electrophoresis

  • Set consistent threshold values across comparable experiments

  • Include no-template controls in each run

This methodology has been successfully employed to detect LHX2 mRNA expression in breast cancer cell lines and provides reliable quantification for correlation with protein expression and functional studies .

What are common challenges in LHX2 antibody-based experiments and how can they be addressed?

Common Challenges and Solutions in LHX2 Antibody-Based Experiments:

• Non-specific binding issues:

  • Challenge: Cross-reactivity with other LIM domain-containing proteins

  • Solution: Use monoclonal antibodies targeting unique LHX2 epitopes; perform careful validation with positive and negative controls; include absorption controls with recombinant LHX2 protein

• Variability in immunohistochemical staining:

  • Challenge: Inconsistent staining patterns between batches

  • Solution: Standardize fixation times; use automated staining platforms; include reference control slides in each batch; implement quantitative image analysis for objective scoring

• False negatives in low-expressing samples:

  • Challenge: Inability to detect low levels of LHX2 expression

  • Solution: Optimize antigen retrieval conditions; use signal amplification systems (tyramide signal amplification); extend primary antibody incubation time; consider RNA-ISH as a complementary approach

• Antibody lot-to-lot variability:

  • Challenge: Different performance between antibody lots

  • Solution: Purchase larger lots for long-term studies; perform validation with each new lot; maintain detailed records of antibody performance

• Discrepancies between protein and mRNA expression:

  • Challenge: Poor correlation between qPCR and antibody-based protein detection

  • Solution: Assess post-transcriptional regulation; employ multiple antibodies targeting different epitopes; combine with proteomic approaches

• Quantification challenges in heterogeneous tissues:

  • Challenge: Variable LHX2 expression within tumor regions

  • Solution: Use whole-slide imaging; implement spatial analysis of expression patterns; correlate with microdissection-based molecular analyses

• Optimization for multiplex applications:

  • Challenge: Antibody incompatibility in multiplex panels

  • Solution: Test antibody performance in singleplex before multiplexing; carefully select compatible fluorophores; use sequential staining approaches for problematic combinations

These solutions help ensure reliable and reproducible results when using LHX2 antibodies in research applications, particularly in the context of investigating immune infiltration in breast cancer tissues .

How should researchers interpret discordant results between different LHX2 antibody-based assays?

Interpreting Discordant Results Between LHX2 Antibody-Based Assays:

• Systematic Investigation Approach:

  • Document all discordant findings precisely, including detailed methodology

  • Compare antibody specifications (clone, epitope, manufacturer) across assays

  • Evaluate technical variables (fixation, sample preparation, detection systems)

• Epitope Availability Analysis:

  • Different antibodies may target distinct epitopes with varying accessibility in different assay conditions

  • Protein conformation changes between native (flow cytometry) and denatured (Western blot) states

  • Post-translational modifications may mask epitopes in tissue-specific contexts

  • Solution: Use multiple antibodies targeting different LHX2 epitopes to build a comprehensive profile

• Cross-Platform Validation Strategy:

  • When IHC and Western blot results disagree, consider:

    • Western blot detects total protein while IHC reveals spatial distribution

    • Different sensitivity thresholds between techniques

    • Subcellular localization differences (nuclear vs. cytoplasmic fractions)

  • Utilize orthogonal methods (RNA-seq, mass spectrometry) to resolve discrepancies

• Statistical Approach to Discordance:

  • Calculate Spearman's rank correlation coefficients between paired assay values

  • Identify patterns in discordance (systematic bias vs. random variation)

  • Apply mathematical modeling to understand antibody kinetics across platforms

• Decision Tree for Result Interpretation:

  • If multiple antibody-based assays agree: High confidence in results

  • If only one assay shows positivity: Consider epitope-specific biology or false positivity

  • If results contradict across platforms: Prioritize functional validation experiments

• Reporting Recommendations:

  • Transparently document all discordant findings

  • Provide detailed methodological information for each assay

  • Discuss biological hypotheses that could explain discrepancies

  • If discordance persists, consider antibody engineering approaches to improve specificity

Understanding the biophysical basis of antibody-antigen interactions can help explain discordant results and guide the development of more specific antibodies for LHX2 detection across different experimental platforms .

What controls are essential when using LHX2 antibodies in mechanistic studies of immune infiltration?

Essential Controls for LHX2 Antibody-Based Mechanistic Studies of Immune Infiltration:

• Antibody Validation Controls:

  • Positive tissue controls: Known LHX2-expressing tissues (developing brain, certain cancer types)

  • Negative tissue controls: Tissues with confirmed absence of LHX2 expression

  • Absorption controls: Pre-incubation of antibody with recombinant LHX2 protein

  • Isotype controls: Matched isotype antibody at identical concentration to assess non-specific binding

  • Genetic controls: LHX2 knockout/knockdown samples compared to wild-type

• Experimental Design Controls:

  • Technical replicates: Minimum triplicate samples to assess method reproducibility

  • Biological replicates: Multiple patient samples or experimental models

  • Time-course controls: Samples collected at multiple timepoints to track dynamic changes

  • Fixation controls: Comparison of different fixation protocols to rule out fixation artifacts

• Pathway Analysis Controls:

  • Pathway inhibitor controls: PI3K/AKT/mTOR pathway inhibitors to confirm mechanism

  • Phosphorylation controls: Phosphorylated and non-phosphorylated protein standards

  • Loading controls: Housekeeping proteins (β-actin, GAPDH) for Western blot normalization

• Immune Infiltration Analysis Controls:

  • Single stain controls: Individual antibody staining for multiplex panel optimization

  • Fluorophore minus one (FMO) controls: To set gates and thresholds in flow cytometry

  • Spatial distribution controls: Analysis of tumor center vs. invasive margin

  • T-cell subset controls: Include markers for Th1 and Th2 cells given their positive correlation with LHX2 expression

• Functional Validation Controls:

  • LHX2 overexpression controls: To confirm gain-of-function effects

  • LHX2 silencing controls: siRNA or shRNA knockdown to confirm loss-of-function

  • Rescue experiments: Re-expression of LHX2 in knockdown models

  • In vivo controls: Matched tumor-bearing mice with and without LHX2 manipulation

Implementation of these comprehensive controls ensures robust and reproducible results when investigating the mechanistic role of LHX2 in immune infiltration, particularly in the context of breast cancer research .

How might antibody engineering approaches enhance LHX2-targeted research applications?

Advanced Antibody Engineering Approaches for Enhanced LHX2 Research:

• Biophysics-Informed Antibody Design:

  • Recent advances combine experimental selection data with computational models to design antibodies with customized specificity profiles

  • This approach enables the identification of different binding modes associated with particular LHX2 epitopes

  • Using phage display experiments with antibody libraries, researchers can now generate variants with either highly specific binding to particular LHX2 domains or cross-specificity for multiple epitopes

• Complementarity-Determining Region (CDR) Optimization:

  • Systematic variation of CDR3 amino acid sequences can yield antibodies with dramatically improved specificity

  • High-throughput sequencing combined with computational analysis provides additional control over specificity profiles beyond traditional selection methods

  • Libraries based on a single naïve human VH domain with varied CDR3 positions have successfully generated antibodies with enhanced specificity

• Multi-specific Antibody Formats:

  • Bispecific antibodies targeting both LHX2 and immune checkpoint molecules (PD-1, CTLA-4)

  • Dual-targeting approaches combining LHX2 with markers of specific immune cell populations

  • Fragment-based approaches (Fab, scFv) for improved tissue penetration in complex tumor microenvironments

• Intracellular Antibody Development:

  • Engineering cell-penetrating antibodies to target nuclear LHX2

  • Intrabodies expressed from gene constructs to modulate LHX2 function in living cells

  • Nanobody-based approaches for targeting transcription factor activity

• Functional Antibody Enhancements:

  • Site-specific conjugation of fluorophores for improved imaging applications

  • Antibody-drug conjugates for targeted therapy in LHX2-overexpressing tumors

  • pH-sensitive antibodies optimized for tumor microenvironment conditions

The combination of biophysics-informed modeling with extensive selection experiments offers a powerful toolset for designing LHX2 antibodies with precisely tuned binding properties, enabling more sophisticated research applications and potential therapeutic development .

What are the implications of LHX2's role in immune infiltration for immunotherapy research?

Implications of LHX2's Immune Infiltration Role for Immunotherapy Research:

• Predictive Biomarker Potential:

  • LHX2 expression correlates with T-cell activation pathways, suggesting potential as a predictive biomarker for immunotherapy response

  • The positive correlation between LHX2 and specific immune cell populations (Th1 and Th2 cells) indicates its utility in patient stratification for immunotherapy trials

  • Quantitative assessment of LHX2 expression could help identify patients likely to benefit from immune checkpoint inhibitors

• Novel Therapeutic Target Development:

  • LHX2's role in activating the PI3K/AKT/mTOR pathway suggests potential synergies with pathway inhibitors combined with immunotherapy

  • As LHX2 influences apoptosis pathways, combination approaches targeting both immune activation and apoptosis resistance might enhance efficacy

  • Targeting transcription factors like LHX2 could represent a novel approach to modulating the tumor immune microenvironment

• Immune Checkpoint Interactions:

  • Research into interactions between LHX2 and established immune checkpoint molecules (PD-1/PD-L1, CTLA-4) could reveal new immunoregulatory mechanisms

  • LHX2-blocking approaches might complement existing checkpoint inhibitors, potentially addressing resistance mechanisms

  • The development of first-in-class blocking antibodies (similar to BND-22 for ILT2) could pioneer new immunomodulatory strategies

• T Cell Engineering Applications:

  • Understanding LHX2's influence on T cell function could inform engineering of more effective CAR-T cells for solid tumors

  • LHX2-responsive promoters might enable development of smart CAR-T cells with context-dependent activation

  • T cell therapies could be optimized based on LHX2 expression profiles in target tumors

• Combination Therapy Rationales:

  • LHX2's multifaceted roles suggest rational combinations of:

    • LHX2-targeting agents with immune checkpoint inhibitors

    • PI3K/AKT/mTOR pathway inhibitors with immunotherapies

    • Approaches targeting both cancer cells and the immune microenvironment

These implications highlight the potential significance of LHX2 as both a biomarker and therapeutic target in the evolving landscape of cancer immunotherapy research .

How can longitudinal monitoring of LHX2 expression inform treatment response assessment in clinical research?

Longitudinal Monitoring of LHX2 Expression for Treatment Response Assessment:

• Dynamic Biomarker Profiling:

  • Implement serial sampling protocols to capture temporal changes in LHX2 expression during treatment

  • Apply mathematical modeling approaches similar to those used in antibody kinetics studies:

    • Production rates (AbPr1, AbPr2) can be adapted to model LHX2 expression dynamics

    • Clearance rates (r) help predict time to plateau or peak expression

    • Mathematical formulations like Ab(t) = (AbPr1/r)(1-e^(-rt)) can be modified for LHX2 expression patterns

• Multi-Modal Assessment Strategy:

  • Combine tissue biopsies, liquid biopsies, and imaging approaches to create comprehensive profiles

  • Correlate changes in LHX2 expression with:

    • Radiological response (RECIST criteria)

    • Immune infiltration dynamics

    • Activation status of the PI3K/AKT/mTOR pathway

• Treatment Response Prediction Models:

  • Develop predictive algorithms incorporating:

    • Baseline LHX2 expression

    • Early dynamic changes (percent change from baseline)

    • Patterns of change (continuous decline vs. fluctuating patterns)

  • Validate models using prospective clinical trial cohorts

• Sampling Frequency Optimization:

  • High-frequency sampling during early treatment phase (weeks 1-8)

  • Reduced frequency during maintenance phase

  • Strategic sampling at treatment decision points

  • Statistical power calculations to determine minimum required sampling frequency

• Integration with Immune Monitoring:

  • Correlate LHX2 expression changes with:

    • T cell infiltration dynamics (particularly Th1 and Th2 subsets)

    • Changes in immune checkpoint molecule expression

    • Cytokine profiles in the tumor microenvironment

  • This integrated approach provides mechanistic insights into treatment effects

• Clinical Trial Applications:

  • Incorporate LHX2 longitudinal monitoring as exploratory endpoints in trials of:

    • Immunotherapies (checkpoint inhibitors, cell therapies)

    • Targeted therapies (PI3K/AKT/mTOR inhibitors)

    • Combination approaches

This longitudinal monitoring approach offers superior insights compared to single-timepoint assessments, potentially enabling early identification of responders and non-responders, adaptive treatment strategies, and mechanistic understanding of treatment effects .