lyrm2 Antibody

What is LYRM2 and why is it important in scientific research?

LYRM2 (LYR Motif Containing 2) is a conserved member of the leucine-tyrosine-arginine motif-containing proteins (LYRMs) family that regulates mitochondrial activities by serving as a subunit of mitochondrial complexes. Recent research has revealed that LYRM2 has significant implications in cancer biology, particularly in hepatocellular carcinoma (HCC). Its importance stems from its newly discovered role in promoting cancer growth and metastasis through metabolic reprogramming, specifically by enhancing HIF-1α-dependent glucose metabolism . Understanding LYRM2's functions provides crucial insights into mitochondrial biology and potential therapeutic targets for cancer treatment.

What types of LYRM2 antibodies are available for research applications?

Several types of LYRM2 antibodies are available for research, including:

• Antibodies targeting different epitopes:

  • N-terminal region antibodies (e.g., targeting AA 19-47)

  • C-terminal region antibodies

  • Full-length or large fragment antibodies (e.g., AA 1-88)

• Based on conjugation status:

  • Unconjugated antibodies for flexible application development

  • Conjugated antibodies with various detection tags:

    • HRP-conjugated for enhanced chemiluminescent detection

    • Biotin-conjugated for streptavidin-based detection systems

    • FITC-conjugated for direct fluorescence applications

• Based on host species and clonality:

  • Polyclonal rabbit antibodies are most common for LYRM2 detection

  • Monoclonal antibodies for specific epitope recognition

How does LYRM2 function in normal cellular processes versus pathological conditions?

In normal cellular processes, LYRM2 primarily functions in regulating mitochondrial activities as a subunit of mitochondrial complexes, particularly in mitochondrial complex I. It plays a role in oxidative phosphorylation and energy metabolism in healthy cells.

In pathological conditions, particularly cancer, LYRM2 exhibits altered expression and function. In hepatocellular carcinoma, LYRM2 is significantly overexpressed compared to normal tissues and correlates with adverse clinicopathological features and poor prognosis. In this context, LYRM2 promotes:

• Cancer cell proliferation through enhanced metabolic activity

• Increased cell migration and invasion capabilities

• Epithelial-mesenchymal transition (EMT), as evidenced by alterations in E-cadherin, N-cadherin, and vimentin expression

• HIF-1α protein stabilization, which drives glycolysis and inhibits mitochondrial respiration

• Metabolic reprogramming toward increased glucose utilization

Similar oncogenic functions have been reported in colorectal cancer, where LYRM2 promotes oxidative phosphorylation and cancer cell growth through interactions with mitochondrial complex I.

What are the optimal protocols for antibody validation when using LYRM2 antibodies?

Comprehensive validation of LYRM2 antibodies is essential to ensure experimental reliability. The recommended validation protocol includes:

• Western Blot Validation:

  • Use cell lysates with known LYRM2 expression levels (positive and negative controls)

  • Verify band appears at expected molecular weight (~11-12 kDa for human LYRM2)

  • Include knockdown or knockout controls using confirmed LYRM2 shRNAs (e.g., shLYRM2-#1: CCGGGTCACTAGAATGGCTGTAATTACTCGAGTAATTACAGCCATTCTAGTGATTTTTG)

• Immunohistochemistry (IHC) Validation:

  • Test on FFPE tissue sections with known LYRM2 expression

  • Use recommended dilution (typically 1:100 for anti-LYRM2 antibodies)

  • Include positive control tissues (HCC samples) and negative control tissues

  • Verify expected subcellular localization pattern

• Specificity Testing:

  • Peptide competition assay using the immunizing peptide

  • Cross-reactivity assessment with related proteins

  • Testing across multiple cell lines with varying LYRM2 expression levels

• Reproducibility Assessment:

  • Batch-to-batch consistency verification

  • Intra-laboratory and inter-laboratory reproducibility

What are the recommended protocols for using LYRM2 antibodies in Western blotting applications?

For optimal Western blotting results with LYRM2 antibodies, follow this detailed protocol:

• Sample Preparation:

  • Extract total protein from cells or tissues using RIPA buffer with protease inhibitors

  • Quantify protein concentration using BCA or Bradford assay

  • Load 20-50 μg of protein per lane

• Gel Electrophoresis and Transfer:

  • Use 12-15% SDS-PAGE gels (optimal for low molecular weight proteins like LYRM2)

  • Transfer to PVDF membrane at 100V for 1-2 hours in cold transfer buffer

• Blocking and Antibody Incubation:

  • Block membrane with 5% non-fat milk in TBST for 1 hour at room temperature

  • Incubate with primary anti-LYRM2 antibody at recommended dilution (typically 1:500 to 1:1000)

  • Incubate overnight at 4°C with gentle rocking

  • Wash 3x with TBST, 5-10 minutes each

  • Incubate with appropriate HRP-conjugated secondary antibody (1:5000) for 1 hour at room temperature

  • Wash 3x with TBST, 5-10 minutes each

• Detection and Analysis:

  • Apply ECL substrate and image using chemiluminescence detection system

  • Expected band size for LYRM2 is approximately 11-12 kDa

  • Include positive controls such as HCC cell lines (HCCLM3, MHCC97H or Hep3B)

How should researchers design immunoprecipitation experiments with LYRM2 antibodies?

For effective immunoprecipitation (IP) of LYRM2 and its interacting partners:

• Lysate Preparation:

  • Use gentle lysis buffers (e.g., NP-40 buffer) to preserve protein-protein interactions

  • Include phosphatase and protease inhibitors to prevent degradation

  • Pre-clear lysate with Protein A/G beads to reduce non-specific binding

• Antibody Selection and Incubation:

  • Choose antibodies validated for IP applications

  • Use 2-5 μg of anti-LYRM2 antibody per 500 μg of protein lysate

  • Include appropriate isotype control antibody in parallel experiments

  • Incubate antibody with lysate overnight at 4°C with gentle rotation

• Bead Capture and Elution:

  • Add Protein A/G beads and incubate for 2-4 hours at 4°C

  • Wash 4-5 times with cold IP wash buffer

  • Elute bound proteins using SDS sample buffer or low pH elution buffer

• Co-Immunoprecipitation Considerations:

  • For studying LYRM2-HIF-1α interaction, use crosslinking agents to stabilize transient interactions

  • Verify interaction using reverse IP with anti-HIF-1α antibody

  • Consider proximity ligation assays as complementary technique to validate interactions observed in IP experiments

How can researchers troubleshoot non-specific binding issues with LYRM2 antibodies?

Non-specific binding is a common challenge when working with antibodies. For LYRM2 antibodies, implement these troubleshooting strategies:

• Optimization of Blocking Conditions:

  • Test different blocking agents (BSA, non-fat milk, commercial blockers)

  • Increase blocking time or blocking agent concentration

  • Use casein-based blockers for particularly problematic samples

• Antibody Dilution and Incubation Adjustments:

  • Test serial dilutions of primary antibody (1:250 to 1:2000)

  • Reduce incubation temperature (4°C instead of room temperature)

  • Add 0.1-0.5% Tween-20 or Triton X-100 to antibody dilution buffer

• Washing Protocol Enhancement:

  • Increase number and duration of wash steps

  • Use higher salt concentration in wash buffers (up to 500 mM NaCl)

  • Add 0.1% SDS to wash buffer for Western blotting applications

• Pre-absorption Technique:

  • Pre-incubate antibody with control peptide or recombinant protein

  • Remove antibodies binding to non-specific targets before application

  • Use tissue or cell lysate from LYRM2 knockout/knockdown samples for pre-absorption

• Validation with Multiple Antibodies:

  • Confirm results using antibodies targeting different epitopes of LYRM2

  • Compare polyclonal with monoclonal antibodies for specific applications

What are the critical quality control parameters for assessing LYRM2 antibody performance?

To ensure reliable experimental results, assess LYRM2 antibodies using these critical quality control parameters:

• Specificity Assessment:

  • Verification of single band at correct molecular weight in Western blot

  • Disappearance of signal in LYRM2 knockdown/knockout samples

  • Cross-reactivity testing with similar proteins (other LYRM family members)

• Sensitivity Measurement:

  • Limit of detection determination using serial dilutions of recombinant LYRM2

  • Signal-to-noise ratio calculation across different antibody concentrations

  • Comparison with reference antibodies of known sensitivity

• Reproducibility Testing:

  • Inter-assay coefficient of variation (<15% is acceptable)

  • Intra-assay coefficient of variation (<10% is acceptable)

  • Lot-to-lot consistency verification

• Application-Specific Performance:

  • For IHC: background staining, signal intensity, and subcellular localization assessment

  • For IF: signal intensity, specificity, and background autofluorescence evaluation

  • For IP: recovery efficiency determination compared to input amount

What alternative approaches can be used to confirm LYRM2 antibody specificity?

Confirming antibody specificity is crucial for research reliability. Beyond standard methods, consider these approaches for LYRM2 antibody validation:

• Genetic Engineering Approaches:

  • CRISPR-Cas9 knockout of LYRM2 gene to create negative control cells

  • siRNA or shRNA knockdown with multiple targeting sequences (e.g., shLYRM2-#1 and shLYRM2-#2 as used in published studies)

  • Overexpression systems using LYRM2 cDNA in expression vectors as positive controls

• Mass Spectrometry Validation:

  • Immunoprecipitate LYRM2 and analyze by mass spectrometry

  • Confirm presence of LYRM2 peptides in precipitated samples

  • Identify co-precipitating proteins for interaction studies

• Orthogonal Detection Methods:

  • Correlate antibody signals with mRNA expression levels (qRT-PCR)

  • Use proximity ligation assays to verify protein-protein interactions

  • Compare results with tagged recombinant LYRM2 expression systems

• Tissue and Species Cross-Reactivity:

  • Test antibody across multiple species if claimed to be cross-reactive

  • Assess performance in tissues with known LYRM2 expression patterns

  • Compare staining patterns in normal versus diseased tissues (e.g., HCC versus normal liver)

How can LYRM2 antibodies be utilized to investigate protein-protein interactions in cancer metabolism?

LYRM2 antibodies provide powerful tools for investigating protein-protein interactions critical to cancer metabolism. Advanced approaches include:

• Co-Immunoprecipitation (Co-IP) Analysis:

  • Use anti-LYRM2 antibodies to precipitate LYRM2 and its binding partners

  • Western blot for known interactors such as HIF-1α, which has been demonstrated to interact with LYRM2 in HCC

  • Apply reverse Co-IP with antibodies against suspected interaction partners

  • Quantify binding affinities under various metabolic conditions

• Proximity Ligation Assay (PLA):

  • Visualize and quantify LYRM2 interactions with mitochondrial proteins or HIF-1α at single-molecule resolution

  • Assess subcellular localization of interaction events

  • Compare interaction frequency between normal and cancer cells

• Bimolecular Fluorescence Complementation (BiFC):

  • Create fusion constructs of LYRM2 and potential partners with split fluorescent proteins

  • Monitor real-time interaction dynamics in living cells

  • Assess how metabolic stress affects interaction patterns

• Chromatin Immunoprecipitation (ChIP) Analysis:

  • Investigate if LYRM2-HIF-1α complexes associate with promoters of metabolic genes

  • Map genome-wide binding patterns of these complexes

  • Correlate binding with transcriptional changes in metabolic pathways

What methodologies can researchers use to investigate LYRM2's role in mitochondrial dynamics?

To investigate LYRM2's role in mitochondrial dynamics, researchers can employ these sophisticated methodologies:

• High-Resolution Confocal Microscopy:

  • Co-stain with anti-LYRM2 antibodies and mitochondrial markers

  • Track mitochondrial morphology changes upon LYRM2 knockdown or overexpression

  • Use time-lapse imaging to observe dynamic changes in real-time

• Mitochondrial Fractionation and Proteomic Analysis:

  • Isolate mitochondrial fractions and immunoblot for LYRM2

  • Perform mass spectrometry on LYRM2-associated mitochondrial protein complexes

  • Compare mitochondrial proteome composition between LYRM2-normal and LYRM2-altered samples

• Functional Mitochondrial Assays:

  • Measure oxygen consumption rate (OCR) in cells with modulated LYRM2 expression

  • Assess mitochondrial membrane potential using fluorescent probes

  • Quantify ATP production and relate to LYRM2 expression levels

• In vivo Imaging of Mitochondrial Networks:

  • Use super-resolution microscopy with LYRM2 and mitochondrial markers

  • Quantify parameters of mitochondrial networks (length, branching, fragmentation)

  • Correlate mitochondrial network changes with metabolic shifts in cancer progression

How can researchers apply LYRM2 antibodies in translational research for hepatocellular carcinoma?

LYRM2 antibodies offer significant value in translational HCC research through these approaches:

• Tissue Microarray (TMA) Analysis:

  • Develop immunohistochemistry protocols using anti-LYRM2 antibodies (1:100 dilution)

  • Screen large cohorts of HCC patient samples for LYRM2 expression

  • Correlate expression with clinicopathological features and patient outcomes

  • Create scoring systems for standardized evaluation

• Liquid Biopsy Development:

  • Evaluate LYRM2 protein in circulating tumor cells or exosomes

  • Develop sensitive detection methods using LYRM2 antibodies

  • Assess correlation between circulating LYRM2 and tumor burden or treatment response

• Therapeutic Target Validation:

  • Use antibodies to monitor LYRM2 expression changes following drug treatments

  • Screen for compounds that modulate LYRM2-HIF-1α interaction

  • Develop antibody-drug conjugates targeting LYRM2-expressing cancer cells

• Precision Medicine Applications:

  • Stratify HCC patients based on LYRM2 expression patterns

  • Identify patient subgroups likely to benefit from metabolism-targeting therapies

  • Monitor LYRM2 expression as a biomarker of treatment response

How should researchers quantify and normalize LYRM2 expression data across different experimental platforms?

Proper quantification and normalization are essential for meaningful LYRM2 expression analysis. Implement these research-grade approaches:

• Western Blot Quantification:

  • Use densitometry software to quantify band intensity

  • Normalize LYRM2 signal to appropriate loading controls (β-actin, GAPDH, or mitochondrial proteins like COX IV)

  • Present data as fold-change relative to control samples

  • Include multiple biological replicates (minimum n=3) for statistical analysis

• Immunohistochemistry Scoring:

  • Develop systematic scoring method based on staining intensity and percentage of positive cells

  • Use H-score method (0-300 scale) or similar quantitative approach

  • Employ multiple independent pathologists for scoring

  • Validate scoring with automated image analysis software

• Cross-Platform Normalization:

  • Correlate protein expression (Western blot, IHC) with mRNA levels (qRT-PCR, RNA-seq)

  • Use relative expression ratios rather than absolute values when comparing across platforms

  • Include common reference samples across all experiments as internal calibrators

• Statistical Analysis Requirements:

  • Apply appropriate statistical tests based on data distribution

  • Perform power analysis to determine adequate sample sizes

  • Use multiple comparison corrections for large-scale analyses

  • Present both technical and biological variability measures

What are the potential pitfalls in interpreting LYRM2 antibody-based experimental results?

Researchers should be aware of these potential pitfalls when interpreting LYRM2 antibody-based results:

How can researchers reconcile conflicting data when using different LYRM2 antibodies?

When faced with conflicting results from different LYRM2 antibodies, researchers should follow this systematic reconciliation approach:

• Epitope Mapping Analysis:

  • Compare the epitope regions targeted by each antibody

  • Determine if antibodies recognize different isoforms or splice variants

  • Assess if post-translational modifications affect epitope recognition

• Validation with Orthogonal Methods:

  • Confirm protein expression using mRNA analysis (qRT-PCR, RNA-seq)

  • Use genetic approaches (CRISPR knockout, shRNA knockdown) for validation

  • Apply mass spectrometry to confirm protein identity and abundance

• Controlled Comparative Analysis:

  • Test all antibodies simultaneously under identical conditions

  • Use the same positive and negative controls for all antibodies

  • Create standardized protocols to minimize technical variables

• Methodological Optimization:

  • Adjust antibody concentrations and incubation conditions for each antibody

  • Optimize fixation and antigen retrieval methods for IHC/ICC applications

  • Consider native versus denatured protein detection capabilities