MAN2C1 Antibody

What is MAN2C1 and why is it significant in research?

MAN2C1 is a cytosolic alpha-mannosidase involved in the catabolism of free oligosaccharides (fOSs). It specifically cleaves alpha 1,2-, alpha 1,3-, and alpha 1,6-linked mannose residues on cytoplasmatic free oligosaccharides generated by N-glycoprotein degradation pathways . The significance of MAN2C1 has increased following the identification of its role in neurodevelopmental disorders, as impaired catabolism of free oligosaccharides due to MAN2C1 variants causes neurodevelopmental abnormalities characterized by dysmorphic facial features, intellectual disability, and brain anomalies including polymicrogyria and callosal anomalies . MAN2C1 has also been implicated in cancer biology, with suppression showing increased mitotic arrest and apoptosis in esophageal carcinoma cells, and potential involvement in prostate cancer tumorigenesis . Additionally, MAN2C1 interacts with PTEN (phosphatase and tensin homolog), inhibiting its lipid phosphatase activity .

What are the recommended protocols for using MAN2C1 antibodies in Western blotting?

For Western blotting applications using MAN2C1 antibodies, the following protocol is recommended:

• Sample preparation: Extract proteins from your sample using an appropriate lysis buffer (e.g., HEPES [pH 7.1] 25 mM, PMSF 0.5 mM, antipain/leupeptin 5 μg/mL) .

• Protein quantification: Determine protein concentration using standard methods.

• SDS-PAGE: Load equal amounts of protein and separate by molecular weight.

• Transfer: Transfer proteins to a membrane using standard protocols.

• Blocking: Block the membrane with appropriate blocking buffer.

• Primary antibody incubation: Dilute MAN2C1 antibody at 1:500-1:1000 as recommended . Incubate according to manufacturer's instructions.

• Secondary antibody incubation: Use appropriate HRP-conjugated secondary antibody.

• Detection: Use chemiluminescence for detection.

The expected molecular weight for MAN2C1 is 116 kDa, which should be validated during analysis . Sample-dependent optimization is recommended, and validation data should be consulted before finalizing the protocol .

MAN2C1 antibodies should be stored at -20°C, where they remain stable for one year after shipment . The storage buffer typically contains PBS with 0.02% sodium azide and 50% glycerol at pH 7.3 . Smaller (20μL) sizes may contain 0.1% BSA as a stabilizer . Aliquoting is generally unnecessary for -20°C storage, but for repeated use, aliquoting may prevent freeze-thaw cycles that could compromise antibody performance . When working with the antibody, maintain cold chain practices and avoid contamination. Always centrifuge the product briefly before use to collect the liquid at the bottom of the tube .

How can MAN2C1 antibodies be used to study neurodevelopmental disorders associated with MAN2C1 variants?

MAN2C1 antibodies serve as crucial tools for studying the molecular pathogenesis of MAN2C1-associated neurodevelopmental disorders through several approaches:

• Protein expression analysis: MAN2C1 antibodies can quantify expression levels in patient-derived cells versus controls, revealing how variants affect protein expression . In a recent study, patient fibroblasts showed significantly reduced MAN2C1 expression compared to controls .

• Localization studies: Immunofluorescence using MAN2C1 antibodies can determine if variants affect subcellular localization of the protein, particularly important given MAN2C1's cytosolic role in fOS processing .

• Functional complementation: In isogenic knockout cell lines (e.g., MAN2C1-KO HAP1 cells), antibodies can confirm successful rescue of protein expression following transfection with wild-type or mutant constructs . This approach has confirmed the pathogenicity of multiple MAN2C1 variants .

• Pathway analysis: MAN2C1 antibodies can assess downstream effects of MAN2C1 deficiency on associated pathways, including fOS metabolism and potentially the neuronal apoptotic process (highlighted by RNA sequencing data showing alteration in this pathway in patient cells) .

• Brain organoid models: For studying developmental impacts, MAN2C1 antibodies can evaluate protein expression in brain organoids generated from patient-derived or genetically engineered stem cells, potentially revealing developmental abnormalities related to MAN2C1 dysfunction .

What controls should be included when validating MAN2C1 antibody experiments?

Robust experimental design for MAN2C1 studies should include multiple controls:

• Positive controls: Use tissues/cells with confirmed MAN2C1 expression, such as liver tissue from mouse/rat, which has been validated . HEK293T cells transfected with MAN2C1 expression constructs provide excellent positive controls .

• Negative controls:

  • Technical: Primary antibody omission

  • Biological: MAN2C1 knockdown/knockout models

• Knockdown validation: When using siRNA for MAN2C1 knockdown, antibodies can validate reduction in protein expression. Note that current protocols may achieve approximately 50% reduction in expression, which may be insufficient for certain experiments . A 70-80% decrease in expression is considered optimal for functional studies .

• Isogenic controls: For genetic variant studies, isogenic cell lines where the only difference is the MAN2C1 variant provide the most controlled comparison . CRISPR-Cas9 engineering can be used to create such models .

• Age and sex-matched controls: When analyzing patient samples, both age and sex matching are critical, as demonstrated in brain development studies where controls mismatched for either variable introduced potential confounds .

How can MAN2C1 enzymatic activity be measured in conjunction with antibody-based detection?

MAN2C1 enzymatic activity can be measured using fluorometric assays that complement antibody-based detection of protein levels:

• Spectrofluorimetric assay protocol:

  • Substrate: Use 4-methylumbelliferyl β-D-mannopyranoside (4-MUMan) as the substrate

  • Buffer conditions: Perform the assay at pH 6.5-6.7 in MES or citro-phosphate buffer

  • Sample preparation: Use cell lysates (typically 5 μL of supernatant)

  • Incubation: Incubate with 0.5-1 mM substrate for 1 hour at room temperature

  • Detection: Add stop buffer (0.2 M NaOH-glycine buffer, pH 10.4) and measure fluorescence with excitation at 355-360 nm and emission at 460 nm

  • Quantification: Compare to a standard curve of 4-methylumbelliferone (4-MU)

In patients with MAN2C1 variants, enzymatic activity shows approximately 50% reduction compared to controls (specific activity measured at 0.066 nmols/mg/min in patient samples versus 0.135 nmols/mg/min in controls) .

This combined approach allows researchers to correlate protein levels (detected by antibodies) with functional enzymatic activity, providing insight into how variants affect not only expression but also protein function.

What methodological considerations exist for using MAN2C1 antibodies in immunohistochemistry of brain tissue?

When using MAN2C1 antibodies for brain tissue immunohistochemistry, researchers should consider:

• Fixation protocols: Different fixatives may affect epitope accessibility. Paraformaldehyde fixation (4%) is commonly used for brain tissue, but epitope retrieval methods should be optimized for MAN2C1 detection .

• Specificity validation: Brain tissue contains various glycosidases that may share epitopes with MAN2C1. Validation using MAN2C1-deficient mouse brain sections as negative controls is crucial . MAN2C1-deficient mice show CNS abnormalities including neuronal and glial degeneration, making them valuable control models .

• Co-localization studies: Since MAN2C1 is involved in neurodevelopmental processes, co-staining with neuronal, glial, or developmental markers can provide context for its expression patterns during brain development .

• Developmental timing: MAN2C1 expression may vary throughout development. A temporal analysis across different developmental stages is recommended when studying neurodevelopmental disorders .

• Regional specificity: MAN2C1-associated disorders show specific brain abnormalities including polymicrogyria, interhemispheric cysts, hypothalamic hamartoma, and cerebellar vermis hypoplasia . Examining these specific regions may reveal regionally variable expression or function.

How can researchers optimize MAN2C1 gene knockdown for functional studies?

Current MAN2C1 knockdown protocols using siRNA may require optimization, as documented attempts have achieved only approximately 50% reduction in expression (fold change of 0.505226) , whereas 70-80% reduction is considered necessary for conclusive functional studies. To optimize knockdown efficiency:

• siRNA design and delivery:

  • Test multiple siRNA sequences targeting different regions of MAN2C1 mRNA

  • Optimize transfection conditions (reagent concentration, cell density, incubation time)

  • Consider co-transfection with GFP to sort successfully transfected cells

  • Test different transfection reagents if initial attempts yield insufficient knockdown

• Alternative knockdown approaches:

  • Use shRNA delivered by lentiviral vectors for stable knockdown

  • Consider CRISPR-Cas9 for gene knockout instead of knockdown

  • For temporal control, inducible knockdown systems may be appropriate

• Validation methods:

  • Quantify knockdown efficiency at both mRNA level (RT-PCR) and protein level (Western blot with MAN2C1 antibody)

  • Primers recommended for RT-PCR validation include:

    • 5'GACAGCTTCGGACCCACAT3' and 5'AAAGGTGAACTTCCTGGCCC3'

    • 5'CTATGTCCGCTTCCACACCG3' and 5'CATAGGTGGCCTGGGAACTC3'

  • Include housekeeping genes such as HMBS and B2M for normalization

• Phenotypic assessment:

  • Validate functional consequences of knockdown by measuring MAN2C1 enzymatic activity

  • Assess downstream effects on pathways identified through RNA sequencing, such as the neuronal apoptotic process

What are common causes of variability in MAN2C1 antibody performance?

Several factors can contribute to variability in MAN2C1 antibody performance:

• Antibody specificity: The antibody should be validated for specificity to MAN2C1. Commercial antibodies like 19189-1-AP have been validated against human, mouse, and rat samples , but batch-to-batch variation may occur.

• Sample preparation: Cell lysis methods affect protein extraction efficiency. For MAN2C1, freeze/thaw cycles in liquid nitrogen followed by DNase treatment have been used successfully . Inadequate lysis may result in incomplete extraction of this 116 kDa protein.

• Expression levels: MAN2C1 expression varies across tissues, with liver showing robust expression suitable for positive controls . Brain tissue may show regionally variable expression patterns that complicate interpretation .

• Post-translational modifications: These may affect epitope accessibility. MAN2C1 is involved in glycosylation pathways, and its own modification status could vary under different cellular conditions.

• Experimental conditions: For Western blotting, the recommended dilution range of 1:500-1:1000 should be optimized for each experimental system . Similarly, enzymatic activity assays require optimization of buffer conditions and substrate concentrations .

To minimize variability, researchers should include appropriate controls in each experiment and validate antibody performance in their specific experimental system before proceeding with detailed studies.

How can researchers interpret conflicting data between MAN2C1 protein levels and enzymatic activity?

When MAN2C1 protein levels (determined by antibody detection) do not correlate with enzymatic activity measurements, consider these potential explanations and approaches:

• Variant effects on structure vs. function: Some MAN2C1 variants may affect enzymatic activity without altering expression levels. In patients with MAN2C1 variants, a ~50% decrease in enzymatic activity has been observed , which may not precisely match protein level changes. Perform structure-function analyses based on the location of variants within functional domains.

• Post-translational regulation: MAN2C1 activity may be regulated post-translationally. Investigate potential modifications (phosphorylation, glycosylation) using specific antibodies or mass spectrometry approaches.

• Substrate availability: Enzymatic activity depends on substrate availability. Measure levels of free oligosaccharides in samples to determine if substrate limitation affects activity measurements.

• Interaction partners: MAN2C1 interacts with proteins like PTEN , which may modulate its activity. Co-immunoprecipitation with MAN2C1 antibodies followed by mass spectrometry can identify interaction partners that might affect function.

• Cellular compartmentalization: Although primarily cytosolic, altered subcellular localization could affect substrate access. Use fractionation followed by Western blotting with MAN2C1 antibodies to determine localization patterns.

To resolve discrepancies:

• Perform dose-response experiments comparing protein levels to activity

• Include wild-type MAN2C1 overexpression controls to establish baseline relationships

• Consider developing activity-specific antibodies that recognize the active conformation

What experimental design considerations are critical for studying MAN2C1 in neurodevelopmental disorders?

Research on MAN2C1's role in neurodevelopmental disorders requires careful experimental design:

• Sample size determination: Power analysis from preliminary studies indicates a minimum of 8 patients and 16 controls is necessary to achieve 80% statistical power . Underpowered studies may fail to detect significant differences or overestimate effect sizes.

• Control selection: Both age and sex matching are essential. Studies have identified discrepancies when controls were matched for only one variable . Developmental timing is particularly critical when studying neurodevelopmental processes.

• Model systems:

  • Patient-derived cells provide direct relevance but may show confounding factors from genetic background

  • Isogenic cell lines with targeted MAN2C1 variants provide cleaner comparisons

  • Brain organoids can reveal developmental phenotypes, particularly when combined with CRISPR-Cas9 editing to either introduce or rescue MAN2C1 variants

  • MAN2C1-deficient mice show CNS abnormalities and provide valuable in vivo insights

• Complementary approaches: Combine protein detection (via antibodies), enzymatic activity assays, and transcriptomic analysis (RNA sequencing) for comprehensive assessment . RNA sequencing has identified altered pathways including neuronal apoptotic processes in patients with MAN2C1 variants .

• Temporal considerations: Given MAN2C1's role in neurodevelopment, longitudinal studies or analysis across developmental stages may reveal timing-specific effects that could be missed in single-timepoint studies.

How can MAN2C1 antibodies be used in the development of brain organoid models?

Brain organoids represent powerful models for studying neurodevelopmental disorders associated with MAN2C1 variants. MAN2C1 antibodies can be integrated into brain organoid research in several ways:

• Expression pattern characterization: Immunostaining with MAN2C1 antibodies can track expression throughout organoid development, establishing baseline spatiotemporal patterns in control organoids versus those with MAN2C1 variants or knockdown .

• Genetic engineering validation: When using CRISPR-Cas9 to introduce or rescue MAN2C1 variants in stem cells used for organoid generation, antibodies provide essential validation of gene editing effects at the protein level .

• Structural phenotyping: MAN2C1 variants are associated with specific brain abnormalities including polymicrogyria and cerebellar vermis hypoplasia . Immunohistochemistry with MAN2C1 antibodies alongside structural markers can correlate protein expression with developing organoid architecture.

• Co-localization studies: Double immunostaining with MAN2C1 antibodies and markers for neural progenitors, neurons, or glial cells can reveal cell type-specific roles during neurodevelopment.

• Rescue experiments: In organoids derived from patient cells or engineered to carry MAN2C1 variants, antibodies can confirm successful rescue of protein expression following gene therapy approaches, correlating protein restoration with phenotypic outcomes .

The planned approach documented in research includes both introducing MAN2C1 variants into healthy embryonic stem cells and rescuing variants in patient-derived cells, using CRISPR-Cas9 technology with antibody-based validation .

What opportunities exist for using MAN2C1 antibodies in conjunction with advanced imaging techniques?

Integrating MAN2C1 antibodies with advanced imaging technologies offers several research opportunities:

• Super-resolution microscopy: Techniques like STORM or STED combined with MAN2C1 immunolabeling can reveal subcellular localization at nanoscale resolution, potentially identifying previously unrecognized spatial organization patterns relevant to its function in fOS processing.

• Live cell imaging: Developing fluorescently tagged antibody fragments or nanobodies against MAN2C1 could enable live tracking of protein dynamics in cellular models, revealing temporal aspects of its function.

• Expansion microscopy: This technique physically expands samples to improve resolution. When combined with MAN2C1 immunostaining, it could reveal detailed distribution patterns in complex tissues like brain, particularly valuable for studying the neurodevelopmental disorders associated with MAN2C1 variants .

• Multiplexed imaging: Technologies like Imaging Mass Cytometry or CODEX can simultaneously detect dozens of proteins. Including MAN2C1 antibodies in such panels could reveal relationships with other proteins across large tissue areas, particularly valuable in heterogeneous tissues like developing brain.

• Correlative light and electron microscopy (CLEM): This approach combines the specificity of immunofluorescence with ultrastructural detail from electron microscopy. For MAN2C1, this could reveal associations with specific subcellular structures involved in glycoprotein processing.

• Spatial transcriptomics with protein validation: Combining spatial transcriptomics with MAN2C1 immunohistochemistry could correlate transcript and protein levels across tissue regions, revealing potential post-transcriptional regulation mechanisms.

How might MAN2C1 antibodies contribute to therapeutic development for associated disorders?

MAN2C1 antibodies can facilitate therapeutic development for MAN2C1-associated neurodevelopmental disorders in several ways:

• Therapeutic target validation: Antibodies can confirm target engagement in high-throughput screens for small molecules that might enhance residual MAN2C1 activity or stabilize mutant proteins.

• Pharmacodynamic biomarkers: In potential clinical trials, MAN2C1 antibodies could serve as tools to measure changes in protein levels or localization following therapeutic intervention.

• Enzyme replacement monitoring: For enzyme replacement approaches, antibodies distinguishing between endogenous and exogenous MAN2C1 would be valuable for tracking distribution and persistence of replacement therapy.

• Gene therapy development: In gene therapy approaches, antibodies provide essential validation of transgene expression. The documented experimental approach using CRISPR-Cas9 to rescue MAN2C1 gene function in brain organoids provides proof-of-concept for potential therapeutic strategies .

• Patient stratification: Given the diverse phenotypes associated with different MAN2C1 variants , antibodies could help characterize variant-specific effects on protein expression, localization, or stability, potentially guiding personalized therapeutic approaches.

• Mechanism-based combination therapies: RNA sequencing data from patient cells has identified downstream pathway alterations, including neural apoptotic processes . Antibodies could monitor how MAN2C1-targeted therapies affect these downstream pathways, potentially identifying synergistic intervention points.

While therapeutic development for MAN2C1-associated disorders is still in early stages, antibody-based tools will be essential for target validation, mechanism studies, and therapeutic monitoring.