MINK1 Antibody

What is MINK1 and why is it significant in cellular research?

MINK1 (Misshapen-like kinase 1) is a serine/threonine kinase belonging to the Protein kinase superfamily, specifically the STE Ser/Thr protein kinase family, STE20 subfamily. The full-length protein has a molecular weight of approximately 149,822 daltons with 5 identified isoforms . MINK1 plays critical roles in various cellular processes including cytoskeletal organization, cell migration, and signal transduction pathways. Research has shown its involvement in regulating focal adhesion formation, AKT phosphorylation, and the NLRP3 inflammasome activation, making it a significant target for studies in cell biology, immunology, and cancer research .

What applications are MINK1 antibodies validated for in research settings?

MINK1 antibodies have been validated for multiple research applications including:

These applications enable researchers to investigate MINK1 expression, localization, interactions, and modifications in various experimental contexts .

What are the optimal sample preparation methods for MINK1 western blotting?

For optimal western blot detection of MINK1:

• Tissue selection: Brain tissue from mouse or rat provides strong endogenous signal due to high MINK1 expression levels .

• Lysis buffer composition: Use TNE buffer (recommended for preserving MINK1 protein complexes) containing protease and phosphatase inhibitors to prevent degradation and preserve phosphorylation status .

• Sample handling: Process tissues quickly at 4°C to maintain protein integrity and phosphorylation state.

• Protein loading: Load 20-50 μg of total protein per lane; MINK1 should be visible at approximately 150 kDa.

• Antibody dilution: Start with 1:500-1:1000 dilution for primary antibody incubation (typically overnight at 4°C) .

• Controls: Include brain tissue lysate as positive control and validate specificity with MINK1 knockdown samples where possible.

When investigating MINK1 phosphorylation events or interactions, consider using phospho-specific antibodies or co-immunoprecipitation approaches respectively .

How should MINK1 antibodies be stored and handled to maintain optimal activity?

To maintain MINK1 antibody performance:

• Storage temperature: Store antibodies at -20°C for long-term stability. Antibodies with glycerol (typically 50%) can be stored at -20°C without aliquoting .

• Short-term storage: For frequent use over 1 month, store at 4°C to avoid freeze-thaw cycles .

• Aliquoting: For antibodies without glycerol, prepare small aliquots to minimize freeze-thaw cycles, which can degrade antibody quality.

• Handling precautions:

  • Avoid repeated freeze-thaw cycles

  • Maintain sterile conditions when handling

  • Briefly centrifuge antibody vials after thawing to collect solution

  • Never vortex antibody solutions (gentle mixing only)

• Stability timeline: Most MINK1 antibodies are stable for one year when stored properly at -20°C in the manufacturer-provided buffer (typically PBS with 0.02% sodium azide and 50% glycerol, pH 7.3) .

How can MINK1 antibodies be used to investigate its role in cell migration and cytoskeletal organization?

MINK1 plays a critical role in regulating cell migration through several mechanisms that can be investigated using specific antibody-based approaches:

• Immunofluorescence analysis: Use MINK1 antibodies (dilution 1:20-1:200) alongside markers for focal adhesions (like vinculin) and actin cytoskeleton to study:

  • Changes in focal adhesion size and distribution

  • Actin cytoskeleton reorganization

  • MINK1 co-localization with migration-associated proteins

• Phosphorylation analysis: MINK1 phosphorylates several substrates involved in migration, including PRICKLE1 (at T370) and LL5β (at T894). Use phospho-specific antibodies alongside total MINK1 antibodies to:

  • Track activation state during migration

  • Correlate phosphorylation with cytoskeletal changes

• Complex formation studies: MINK1 functions in a complex with PRICKLE1 that regulates the PRICKLE1-LL5β-CLASP1/2 complex formation. Use co-immunoprecipitation with MINK1 antibodies to:

  • Pull down interaction partners

  • Analyze complex formation in migrating vs. non-migrating cells

Research has shown that inhibition of MINK1 catalytic activity (e.g., using KY05009 inhibitor) decreases cell motility, increases focal adhesion size, and promotes cell spreading, mimicking the phenotype of MINK1 knockdown .

What is known about MINK1's role in inflammasome activation and how can antibodies help investigate this function?

MINK1 plays a critical role in NLRP3 inflammasome priming in macrophages, particularly through phosphorylation of Ser725. This function can be investigated using several antibody-based approaches:

• Comparative analysis in WT vs. Mink1−/− systems: Knockout macrophages show impaired NLRP3 inflammasome activation characterized by:

  • Reduced IL-1β cleavage and caspase-1 maturation

  • Lower IL-1β and IL-18 secretion

  • Decreased ASC oligomerization and speck formation

• Phospho-specific detection: Antibodies targeting phosphorylated NLRP3 (Ser725) can help track MINK1-dependent phosphorylation events.

• Co-immunoprecipitation approaches: MINK1 antibodies can pull down:

  • NLRP3 complex components in wild-type cells

  • Phosphorylated substrates

  • Interacting adaptor proteins

• Immunoblotting for downstream effectors: After stimulation with inflammasome activators (ATP, nigericin, alum), use antibodies against:

  • Pro-IL-1β and mature IL-1β

  • Pro-caspase-1 and active caspase-1 p20/p10

  • ASC and oligomerized ASC

This research direction is particularly valuable for understanding inflammatory diseases and potential therapeutic targeting .

What are common issues with MINK1 immunohistochemistry and how can they be resolved?

When performing IHC with MINK1 antibodies, researchers may encounter several challenges:

• Weak or absent signal:

  • Solution: Optimize antigen retrieval using TE buffer pH 9.0 (primary recommendation) or citrate buffer pH 6.0 as an alternative

  • Method: Heat-induced epitope retrieval (HIER) for 15-20 minutes

  • Antibody concentration: Use higher concentration (1:20-1:50) for tissues with lower expression

• High background staining:

  • Solution: Increase blocking time (1-2 hours) with 5-10% normal serum

  • Method: Add 0.1-0.3% Triton X-100 for better antibody penetration

  • Washing: Extend wash steps (3-5x with PBS-T)

• Non-specific binding:

  • Solution: Pre-absorb antibody with control peptide if available

  • Method: Include additional blocking with 0.1% BSA

  • Controls: Always include negative controls (no primary antibody)

• Tissue-specific considerations:

  • Brain tissue typically shows strong MINK1 expression

  • Human lymphoma and skeletal muscle tissue have been validated for positive staining

  • For other tissues, optimization of fixation time may be necessary

• Validation strategies:

  • Use MINK1 knockdown tissues as negative controls

  • Compare staining pattern with RNA expression data

  • Verify with second MINK1 antibody targeting different epitope

How can researchers validate the specificity of MINK1 antibodies in their experimental systems?

Validating antibody specificity is crucial for reliable experimental results. For MINK1 antibodies, consider these validation approaches:

• Genetic validation:

  • Use MINK1 knockout or knockdown models (siRNA, shRNA)

  • Example: shRNA MINK1 (#03) targeting sequence AGCGGCTCAAGGTCATCTATG has been validated in MDA-MB231 cells

  • Compare western blot signals between control and knockdown/knockout samples

• Peptide competition assay:

  • Pre-incubate antibody with immunizing peptide

  • Signal should be substantially reduced or eliminated if antibody is specific

• Multi-antibody approach:

  • Test multiple antibodies against different MINK1 epitopes

  • Results should show consistent patterns across antibodies

• Recombinant protein controls:

  • Use purified recombinant MINK1 as positive control

  • Test against other related kinases (e.g., MAP4K4, TNIK) to confirm specificity

• Mass spectrometry validation:

  • Perform immunoprecipitation followed by mass spectrometry

  • Confirm pulled-down protein is indeed MINK1

• Application-specific validation:

  • For WB: Verify correct molecular weight (~150 kDa)

  • For IHC: Compare with known expression patterns and RNA-seq data

  • For IP: Analyze pull-down efficiency and specificity

Researchers have validated MINK1 antibody specificity using western blot analysis in MINK1 knockdown models, confirming downregulation of the expected 150 kDa band .

How can MINK1 antibodies be used to investigate its role in cancer cell signaling?

MINK1 has emerged as an important regulator in cancer cell signaling pathways, particularly in triple-negative breast cancer (TNBC). Several antibody-based experimental approaches can elucidate these functions:

• Signaling pathway analysis:

  • MINK1 affects AKT phosphorylation - use phospho-specific antibodies to detect pAKT (S473) reduction upon MINK1 inhibition or knockdown

  • MINK1 inhibitor KY05009 (IC50 = 1.2 nM) decreases AKT phosphorylation in MDA-MB-231 cells

• Phosphoproteomic approaches:

  • Use SILAC (Stable Isotope Labeling with Amino acids in Cell culture) combined with MINK1 antibodies for immunoprecipitation

  • In a published example, this approach identified 1323 differentially expressed phosphopeptides in MINK1 knockdown cells

• Substrate identification workflow:

  • Immunoprecipitate MINK1 using specific antibodies

  • Perform in vitro kinase assays with potential substrates

  • Validate with phospho-specific antibodies (e.g., PRICKLE1 T370, LL5β T894)

• Migration and invasion studies:

  • Use MINK1 antibodies for immunofluorescence to track focal adhesion changes

  • Compare focal adhesion size in control vs. MINK1-inhibited cells

  • MINK1 inhibition increases focal adhesion size and reduces cell motility

• MINK1-dependent complex formation:

  • Immunoprecipitate with MINK1 antibodies to pull down interaction partners

  • MINK1 kinase activity promotes PRICKLE1-LL5β interaction and membrane localization

  • Inhibition of MINK1 disrupts this complex and alters cell morphology

These approaches provide molecular insights into how MINK1 contributes to cancer cell behavior, potentially identifying therapeutic targets.

How should researchers interpret MINK1 phosphorylation data in relation to its kinase activity?

Interpreting MINK1 phosphorylation data requires careful consideration of several factors:

• MINK1 autophosphorylation vs. substrate phosphorylation:

  • MINK1 undergoes autophosphorylation, which can be detected in immunoprecipitated samples

  • Distinguish between MINK1 activation (autophosphorylation) and substrate phosphorylation events

• Known substrate phosphorylation patterns:

  • PRICKLE1: MINK1 phosphorylates T370, creating phosphorylation motif D[ST]Lx[RK][RK]

  • LL5β: MINK1 phosphorylates T894

  • Use phospho-specific antibodies to monitor these events as readouts of MINK1 activity

• Pathway crosstalk considerations:

  • MINK1 affects AKT phosphorylation on S473

  • AKT pathway activation/inhibition can confound interpretation of MINK1-specific effects

  • Control experiments should include specific MINK1 inhibitors (e.g., KY05009)

• Experimental validation approaches:

  • Compare wild-type MINK1 with kinase-dead mutants

  • Use specific inhibitors at appropriate concentrations (KY05009 at 1 μM)

  • Include time-course experiments to distinguish direct vs. indirect phosphorylation events

• Technical considerations in phosphorylation detection:

  • For western blots, always strip and reprobe for total protein

  • For mass spectrometry, ensure adequate phosphopeptide enrichment (e.g., TiO2 columns)

  • Control for phosphatase activity with appropriate inhibitors during sample preparation

When interpreting phosphoproteomic data from SILAC experiments, researchers should cross-reference with known MINK1 interaction partners to identify potential direct substrates versus downstream effects .

What is known about MINK1's role in inflammatory pathways and what experimental approaches can investigate this function?

MINK1 has been identified as a critical regulator of inflammatory pathways, particularly in the priming of NLRP3 inflammasome activation in macrophages. Researchers can investigate this function using several experimental approaches:

• Comparative analysis using Mink1−/− models:

  • Mink1−/− bone marrow-derived macrophages (BMDMs) show impaired NLRP3 inflammasome activation when triggered with standard activators (ATP, nigericin, alum)

  • This manifests as reduced IL-1β cleavage, caspase-1 maturation, and decreased IL-1β/IL-18 secretion

  • ASC oligomerization and speck formation are also reduced in Mink1−/− cells

• Phosphorylation analysis:

  • MINK1 mediates phosphorylation of Ser725 in NLRP3, an essential step for inflammasome priming

  • Use phospho-specific antibodies to detect this modification

  • Compare phosphorylation levels in wild-type vs. MINK1-deficient cells

• Dose-response studies:

  • Test NLRP3 activation across ATP concentrations (1-3 mM)

  • MINK1-deficient cells show reduced IL-1β secretion across this range

• Pathway integration analysis:

  • Investigate how MINK1 connects to canonical NF-κB signaling

  • Assess transcriptional vs. post-translational effects on inflammasome components

• Therapeutic targeting approaches:

  • Test MINK1 inhibitors (e.g., KY05009) in inflammatory disease models

  • Measure inflammasome-dependent cytokine production

These experimental approaches can help elucidate MINK1's role in inflammatory conditions and potentially identify new therapeutic strategies.

How can researchers use MINK1 antibodies to study its interactions with the Striatin-interacting phosphatase and kinase (STRIPAK) complex?

MINK1 has been identified as a novel component of Striatin complexes, specifically the STRIPAK complex. Researchers can investigate these interactions using several antibody-based approaches:

• Co-immunoprecipitation strategies:

  • Use anti-FLAG antibody to immunoprecipitate FLAG-PPP2R1A (a STRIPAK component) and detect co-precipitated MINK1

  • Immunoprecipitate GFP-MINK1 and probe for Striatin complex components (STRN4, PPP2R1A, PPP2CA)

  • Elute complexes with FLAG-peptide for downstream analyses

• Activity regulation studies:

  • Examine MINK1 kinase activity in the presence of purified PPP2R1A/PPP2CA/STRN4 complexes

  • Incubate immunoprecipitated GFP-MINK1 with FLAG-STRN4 and different amounts of FLAG-PPP2R1A/GFP-PPP2CA complex

  • Analyze reaction products by immunoblotting with phospho-specific antibodies

• Complex formation analysis:

  • Express FLAG-PPP2R1A and GFP-PPP2CA in 293T cells

  • Purify the complex using anti-FLAG immunoprecipitation

  • Quantify complex formation by immunoblot comparison with FLAG-STRN4 standards

• Subcellular localization studies:

  • Use immunofluorescence to track MINK1 co-localization with STRIPAK components

  • Analyze changes in localization during cell cycle progression, particularly during abscission

• Phosphoproteomic approach to identify targets:

  • Perform SILAC-based phosphoproteomics in cells with STRIPAK component knockdowns

  • Compare phosphorylation patterns to MINK1 knockdown cells to identify shared pathways