MLK4 Antibody

What is MLK4 and what cellular pathways does it regulate?

MLK4 (also known as MAP3K21/KIAA1804) is a member of the mixed lineage kinase (MLK) family of serine/threonine kinases that function as MAP3Ks. MLK4 plays critical roles in regulating multiple MAPK signaling pathways, including:

• JNK (c-Jun N-terminal kinase) pathway

• p38 MAPK pathway

• ERK (extracellular signal-regulated kinase) pathway

Unlike other MLK family members that typically activate these pathways, MLK4β has been shown to negatively regulate MAPK activities, acting as a suppressor of MLK3 activation and cell invasion . MLK4 is expressed in various tissues and cell types, with distinct localization patterns including cytoplasmic, membrane, and nuclear distribution depending on cell type .

What are the major isoforms of MLK4 and how do antibodies distinguish them?

MLK4 exists in at least two confirmed isoforms:

• MLK4α: Contains unique C-terminal sequences

• MLK4β: Features distinct structural characteristics affecting function

When selecting antibodies, researchers should note that some antibodies specifically target MLK4α. For example, R&D Systems' AF3435 antibody detects "endogenous human, mouse, and rat MLK4 alpha" because the "peptide immunogen corresponds to a region at the C-terminus of MLK4 alpha absent in MLK4 beta" . For comprehensive MLK4 studies, researchers should verify which isoform(s) their selected antibody detects.

What are standard applications for MLK4 antibodies in research?

MLK4 antibodies are employed in multiple experimental techniques:

Note that optimal dilutions should be determined empirically for each application and antibody .

How should I validate MLK4 antibody specificity for my experiments?

Proper validation is essential before using MLK4 antibodies for critical experiments:

• Positive Controls: Use cell lines with known MLK4 expression (validated examples include K562, Ramos, HeLa, and 293T)

• Knockdown Validation: Conduct siRNA experiments to demonstrate specificity. The search results describe validated sequences:

  • siRNA-01: GGAAAGAUGCUCAGAGAGAUU

  • siRNA-02: AGGAGAAGCCCAAGGAAUU

  • siRNA-03: AGAAGAAACGAGAGGGAAUU

• Multiple Antibody Approach: Use antibodies targeting different epitopes to confirm findings

• Tissue Expression Pattern: Verify expected localization patterns. For example, MLK4 shows "strong cytoplasmic positivity in Purkinje cells" in cerebellum and "localization to plasma membrane & cytosol" in A-431 cells .

What are the optimal protocols for MLK4 antibody detection in tissue samples?

For optimal immunohistochemical detection of MLK4 in paraffin-embedded tissues:

• Section Preparation:

  • Cut paraffin sections at 4 μm thickness

  • Deparaffinize at 70°C for 90 minutes

• Antigen Retrieval:

  • Block endogenous peroxidase with 3% H₂O₂ for 5-10 minutes

  • For paraffin sections, heat-induced epitope retrieval (HIER) at pH 6 is recommended

• Blocking and Primary Antibody Incubation:

  • Block with 5% BSA for 20 minutes at room temperature

  • Incubate with primary antibody (e.g., anti-MLK4 antibody at 1:200 dilution) overnight at 4°C

• Detection System:

  • Wash with TBS containing 0.025% Triton X-100

  • Incubate with HRP-conjugated secondary antibody for 1 hour

  • Develop with DAB for approximately 10 minutes

  • Counterstain as needed (e.g., hematoxylin)

• Analysis:

  • Calculate H-Score by evaluating the proportion of positive and negative pixels

  • Define positive area ratio as: Positive area/total tissue area

  • Consider >50% positive expression rate as positive

How do I troubleshoot non-specific staining or weak signals with MLK4 antibodies?

Common issues and solutions:

How can I use MLK4 antibodies to investigate its role in cancer progression?

MLK4 has been implicated in multiple cancer types with context-dependent functions. To study its role:

• Expression Analysis in Clinical Samples:

  • Use tissue microarrays for immunohistochemical detection of MLK4 in tumor vs. normal tissues

  • Correlate expression with clinicopathological parameters and survival outcomes

  • Example finding: "MLK4 was significantly overexpressed in CESC, and significantly correlated with WHO grade"

• Functional Studies in Cancer Cell Lines:

  • Combine MLK4 antibodies with proliferation assays to assess correlation between expression and growth

  • Detect MLK4 expression changes in response to drug treatments

  • Example: "MLK4 knock-down or inhibition sensitized TNBC cell lines to chemotherapeutic agents in vitro"

• Signaling Pathway Analysis:

  • Use antibodies to detect MLK4 and downstream targets after pathway stimulation

  • Combine with phospho-specific antibodies to measure pathway activation

  • Example application: "MLK4 silencing induced persistent DNA damage accumulation and apoptosis in TNBC cells upon treatment with chemotherapeutics"

• Invasion and Migration Assays:

  • Examine MLK4's role in metastatic capacity through transwell invasion assays

  • "The EDU and transwell assays demonstrated that the decrease in MLK4 expression in C33A cells resulted in a decrease in cell proliferation and invasion"

How do I design experiments to investigate MLK4 mutants found in cancer?

MLK4 mutations are found in multiple cancers including colorectal cancer (7% frequency). To investigate their effects:

• Mutation Characterization Pipeline:

  • Identify mutations of interest from databases (TCGA, COSMIC)

  • Create expression constructs for wild-type and mutant MLK4

  • Express in appropriate cell systems

  • Use antibodies to verify expression levels

  • Assess kinase activity with in vitro assays

• Functional Assessment of Mutations:

  • Most MLK4 mutations in colon cancer are loss-of-function mutations

  • Example methodology: "In vitro kinase assay using inactive MKK7 as a substrate. Mutations located in the kinase domain (H261Y, H261Q, G291E, E314K, Y330H) showed complete loss-of-function towards phosphorylation of MKK7"

• Rescue Experiments:

  • In cell lines with MLK4 mutations, reconstitute with wild-type MLK4

  • Assess changes in oncogenic phenotypes

  • "Restoring MLK4 activity reduced cell viability, proliferation, and colony formation in vitro and delayed tumor growth in vivo"

What methodologies combine MLK4 antibodies with functional assays to study its role in metabolism?

Recent research has uncovered MLK4's role in cellular metabolism, particularly in cancer:

• Metabolic Pathway Analysis:

  • Use MLK4 antibodies in combination with metabolic enzyme antibodies

  • Investigate relationships between MLK4 expression and metabolic markers

  • Example finding: "MLK4 knockdown led to significant reduction of glycolysis and decreased levels of glycolytic pathway metabolites including phosphoenolpyruvate and lactate"

• Transcriptional Regulation Studies:

  • Investigate how MLK4 regulates metabolic enzymes

  • "MLK4 regulated PCK1 expression at transcriptional level, by phosphorylating the transcription factor CREB, which in turn mediated PCK1 expression"

• Integrated Approach:

  • Combine antibody-based detection with mass spectrometry

  • "Metabolic and mass spectrometry analyses showed that MLK4 knockdown led to significant reduction of glycolysis"

  • Link MLK4 signaling to metabolic outputs through combined proteomic and metabolomic approaches

How can I analyze MLK4's role in immune cell infiltration and cancer immunology?

Recent studies show MLK4 has significant immunological functions:

• Immune Cell Analysis:

  • Use MLK4 antibodies in combination with immune cell markers

  • Correlate MLK4 expression with immune infiltration patterns

  • "Multiple analysis algorithms revealed that the high expression of MLK4 was negatively correlated with immune cell infiltration in CESC"

• Cytokine Expression Studies:

  • Investigate how MLK4 affects inflammatory cytokine production

  • "The silencing of MLK4 resulted in a significant increase in the expression of inflammatory cytokines IL-1β(p<0.05), TNF-α(p<0.01), and IL-6 (p<0.05)"

• Immune Checkpoint Correlation:

  • Examine relationships between MLK4 and immune checkpoint molecules

  • "MLK4 mRNA expression was positively correlated with immune checkpoints PD-L1, CTLA4, LAG3, and negatively correlated with immune promotion genes CD86 and CD80"

• Bioinformatic Analysis Pipeline:

  • Use multiple immune scoring methods (ESTIMATE, quanTIseq, TIMER, etc.)

  • Calculate immune infiltration score for each sample

  • Group samples based on infiltration scores

  • Compare with MLK4 expression patterns

What are the optimal storage and handling conditions for MLK4 antibodies?

To maintain antibody quality and performance:

• Storage Recommendations:

  • Store at 4°C for short-term use

  • For long-term storage, aliquot and store at -20°C

  • Avoid freeze-thaw cycles to prevent antibody degradation

• Working Solution Preparation:

  • Dilute in appropriate buffer immediately before use

  • Common formulation: PBS (pH 7.2) with 40% Glycerol and 0.02% Sodium Azide

• Quality Control:

  • Include appropriate positive controls with each experiment

  • Consider time-dependent degradation of antibody performance

  • Validate new lots against previous results

How do different epitope locations affect MLK4 antibody performance?

The choice of epitope target significantly impacts experimental outcomes:

• Epitope Considerations:

  • N-terminal epitopes: May detect all MLK4 isoforms

  • C-terminal epitopes: May be specific to certain isoforms (e.g., MLK4α-specific)

  • Kinase domain epitopes: Ideal for studying catalytic activity

• Recommended Approach:

  • For isoform-specific analysis: Use antibodies with verified specificity

  • For total MLK4 detection: Use antibodies targeting conserved regions

  • For phosphorylation studies: Use phospho-specific antibodies

• Application-Specific Selection:

  • For structural studies: Select antibodies against accessible epitopes

  • For functional studies: Choose antibodies that don't interfere with protein activity

  • For interaction studies: Avoid antibodies targeting binding domains