mtnr1bb Antibody

What is the MTNR1B receptor and why is it important in research?

MTNR1B is one of two high-affinity receptors for melatonin, the primary hormone secreted by the pineal gland. It is an integral membrane protein that functions as a G-protein coupled, 7-transmembrane receptor. The receptor is predominantly found in the retina and brain, although detection in these tissues often requires sensitive techniques like RT-PCR .

MTNR1B is particularly important in research because:

• It mediates the reproductive and circadian actions of melatonin

• Its activity is mediated by pertussis toxin-sensitive G proteins that inhibit adenylate cyclase activity

• Genome-wide association studies have revealed that variation in the MTNR1B gene is associated with insulin and glucose concentrations, linking it to type 2 diabetes (T2D) pathogenesis

Research has shown that MTNR1B is expressed in human pancreatic islets, predominantly in β-cells, contrasting with earlier findings that suggested its expression was primarily in α-cells . This cellular localization has important implications for understanding melatonin's role in glucose regulation.

What are the common applications for MTNR1B antibodies in research?

MTNR1B antibodies are utilized in multiple experimental techniques:

• Western Blot (WB): For detecting MTNR1B protein expression in tissue lysates. Several antibodies have been validated for this application, showing bands at approximately 40-48 kDa depending on the tissue and experimental conditions .

• Immunohistochemistry (IHC): Both paraffin-embedded (IHC-P) and frozen sections (IHC-Fr) can be analyzed to localize MTNR1B in tissues. This has been particularly useful in examining expression in brain, retina, and pancreatic islets .

• Immunocytochemistry/Immunofluorescence (ICC/IF): For cellular localization studies, especially useful in co-localization experiments with other proteins .

• ELISA: Some antibodies have been validated for ELISA applications, allowing quantitative measurement of MTNR1B levels .

The choice of application should guide antibody selection, as not all antibodies perform equally well across different techniques.

What species reactivity should be considered when selecting an MTNR1B antibody?

Species reactivity is a critical consideration when selecting an MTNR1B antibody. Based on the available data:

It's important to note that the Alomone Labs antibody (AMR-032) has been specifically designed to recognize MT2 from rat and mouse samples but is unlikely to recognize the receptor in human samples . Conversely, some antibodies like those from Elabscience and Biorbyt are specifically designed for human samples .

When working with less common model organisms, additional validation may be necessary to confirm cross-reactivity.

How can MTNR1B antibodies be used to study receptor expression in pancreatic islets related to type 2 diabetes research?

MTNR1B has been implicated in type 2 diabetes pathogenesis through genome-wide association studies. Researchers investigating this connection can employ MTNR1B antibodies through several advanced approaches:

• Islet Cell Type-Specific Expression: Immunofluorescence with co-staining for cell-type markers can be used to determine the specific distribution of MTNR1B among different pancreatic islet cell populations. Research has shown that MTNR1B is predominantly expressed in β-cells, contradicting earlier findings suggesting α-cell localization .

• Expression Changes in Disease States: Comparative immunohistochemistry or western blot analysis can be used to assess changes in MTNR1B expression between normal and diabetic tissues. Evidence suggests that non-diabetic individuals carrying the risk allele and patients with T2D showed increased expression of the receptor in islets .

• Functional Studies: After confirming MTNR1B expression using antibodies, researchers can design experiments to assess its functional impact. For example, studies have shown that insulin release from clonal β-cells in response to glucose was inhibited in the presence of melatonin, suggesting a mechanistic link between melatonin signaling and insulin secretion .

• Knockdown Validation: When performing MTNR1B knockdown experiments (e.g., using RNAi), antibodies are essential for confirming successful protein reduction. This approach has revealed that MTNR1B knockdown can significantly promote granulosa cell apoptosis without affecting the cell cycle .

Methodology should include careful antibody titration, appropriate controls (including pre-adsorption with blocking peptides ), and consideration of fixation conditions that may affect epitope recognition in pancreatic tissue.

What are the potential limitations in interpreting data from MTNR1B antibody-based experiments?

Several limitations should be considered when interpreting results from MTNR1B antibody experiments:

• Band Size Discrepancies: The calculated size of MTNR1B is approximately 40.2 kDa according to NP_005950.1, but western blot experiments have shown bands at approximately 48 kDa and 37 kDa in human brain (cerebellum) lysates . These discrepancies could be due to:

  • Post-translational modifications

  • Alternative splicing variants

  • Protein degradation during sample preparation

  • Non-specific binding

• Cross-Reactivity Concerns: Some antibodies may cross-react with MTNR1A, the other melatonin receptor, due to sequence homology. Evidence shows both receptors can be expressed at nearly equal levels in human islets , making specificity validation critical.

• Tissue-Specific Expression Levels: MTNR1B is often expressed at low levels in some tissues, requiring sensitive detection methods. For instance, detection in the brain and retina may require RT-PCR or highly sensitive antibody-based techniques .

• Fixation and Processing Effects: Different fixation methods can affect epitope accessibility. For example, formalin-fixed, paraffin-embedded (FFPE) tissues may require specific antigen retrieval methods for optimal antibody binding .

• Contradictory Findings in Literature: There are contradictions in published results regarding the cellular localization of MTNR1B. Some studies report predominant expression in β-cells, while others suggest α-cell localization , highlighting the need for careful validation.

To mitigate these limitations, researchers should:

• Use multiple antibodies targeting different epitopes

• Include appropriate positive and negative controls

• Validate findings with complementary techniques (e.g., mRNA expression analysis)

• Perform pre-adsorption controls with blocking peptides

How can MTNR1B antibodies be used in multiplex imaging studies to investigate co-localization with other receptors and channels?

Multiplex imaging offers powerful insights into the spatial relationships between MTNR1B and other proteins. Advanced approaches include:

• Sequential Immunofluorescence Protocols:
  Research has successfully demonstrated the co-localization of MTNR1B with voltage-gated sodium channels (Nav1.2) in rat paraventricular nucleus sections. This was achieved by using Anti-Melatonin Receptor 1B Antibody (AMR-032) at 1:600 dilution together with Guinea pig Anti-SCN2A (Nav1.2) Antibody (ASC-002-GP) at 1:2000 dilution . These studies revealed partial co-localization of MT2 and Nav1.2 in the paraventricular nucleus.

• Three-Channel Imaging with Nuclear Counterstain:
  For optimal visualization, MTNR1B can be labeled in red, a second protein of interest in green, with DAPI (blue) used as a nuclear counterstain to provide cellular context . This approach allows clear delineation of cellular compartments and more precise co-localization analysis.

• Co-localization with Angiotensin II Receptors:
  Studies have revealed considerable co-localization between MTNR1B and Angiotensin II Receptor Type-2 in the paraventricular nucleus, using MTNR1B antibody (1:600) alongside Anti-Angiotensin II Receptor Type-2 (extracellular)-ATTO Fluor-488 Antibody (1:100) . This finding has important implications for understanding neuroendocrine signaling integration.

• Methodological Considerations for Tissue Preparation:
  For optimal results in multiplex imaging, perfusion-fixed frozen brain sections have proven effective for maintaining epitope accessibility. This preparation method allows for detection of discrete expression patterns, such as MTNR1B expression in the supraoptic nucleus .

When designing multiplex experiments, researchers should carefully consider antibody compatibility (host species, detection systems), optimize signal-to-noise ratios through titration, and employ appropriate controls to rule out cross-reactivity between detection systems.

What are the optimal conditions for Western blot analysis using MTNR1B antibodies?

Successful Western blot analysis with MTNR1B antibodies requires careful attention to several methodological factors:

• Sample Preparation:

  • Use tissue lysates from appropriate sources: human brain (cerebellum) lysates and mouse/rat brain lysates have been successfully used

  • For cell culture: collect cells at appropriate time points post-treatment/transfection

  • Protein extraction should include protease inhibitors to prevent degradation

  • Total protein concentrations should be quantified using BCA assay or similar methods

• SDS-PAGE Conditions:

  • 12% polyacrylamide gels have been successfully used for MTNR1B separation

  • Load approximately 30 μg of protein per lane

  • Include molecular weight markers that cover the 37-50 kDa range

• Transfer and Blocking:

  • Transfer to polyvinylidene fluoride (PVDF) membrane

  • Block for 1 hour with 5% skim milk in Tris-buffered saline with 0.1% Tween 20 (TBST)

• Antibody Incubation:

  • Primary antibody dilutions vary by manufacturer:

    • Anti-MTNR1B (Abcam): 1:400

    • Anti-Melatonin Receptor 1B (AMR-032): 1:200

  • Incubate overnight at 4°C with gentle agitation

  • Secondary antibody: HRP-labeled species-appropriate secondary antibodies (e.g., goat anti-rabbit) at 1:5,000 dilution

  • Incubate for 1 hour at 37°C

• Detection and Expected Results:

  • Visualize using clarity western ECL substrate and a chemiluminescent imaging system

  • Expected bands:

    • ~40.2 kDa (calculated molecular weight based on NP_005950.1)

    • Some antibodies detect bands at ~48 kDa and 37 kDa in human brain lysates

    • Validation should include blocking peptide controls to confirm specificity

• Troubleshooting:

  • If multiple bands appear, consider using a blocking peptide (such as BLP-MR032) to confirm specificity

  • For weak signals, optimize protein loading amount and antibody concentration

  • Background issues may require more stringent washing steps or higher dilution of antibodies

What are the key considerations for immunohistochemical detection of MTNR1B in different tissue types?

Immunohistochemical (IHC) detection of MTNR1B requires optimization for specific tissue types:

• Tissue Preparation Options:

  • Formalin-fixed, paraffin-embedded (FFPE) tissues:

    • Human brain, retina, cerebellum, and skin melanoma tissues have been successfully stained

    • Require antigen retrieval (typically citrate buffer pH 6)

  • Perfusion-fixed frozen sections:

    • Particularly effective for brain tissues such as paraventricular nucleus and supraoptic nucleus

    • Preserve better antigenicity for some epitopes

• Antibody Selection by Tissue Type:

  • For human tissues: antibodies with confirmed human reactivity (e.g., ab219615, orb1249563)

  • For rodent tissues: species-specific antibodies like AMR-032 (designed for rat/mouse)

• Optimal Antibody Dilutions by Method:

  • FFPE tissues:

    • 3-6 μg/ml for Biorbyt orb1249563

    • 10 μg/ml for Abcam ab219615

  • Frozen sections:

    • 1:600 dilution for AMR-032

• Detection Methods:

  • Chromogenic Detection: AP-staining has been successful with steamed antigen retrieval using citrate buffer pH 6

  • Fluorescence Detection: Especially useful for co-localization studies

• Tissue-Specific Expression Patterns:

  • Human Cerebellum: Primarily shows membranous staining in Purkinje cells

  • Rat Brain: Discrete expression in the supraoptic nucleus (SON)

  • Human Retina: Shows specific staining patterns important for studies of melatonin's role in visual function

• Validation and Controls:

  • Negative controls: pre-incubation with blocking peptide (e.g., BLP-MR032)

  • Positive controls: tissues with known expression (e.g., cerebellum for human tissues)

For multiplexed detection, careful selection of primary antibodies from different host species and appropriate fluorophore-conjugated secondary antibodies is essential to prevent cross-reactivity.

How can researchers validate MTNR1B antibody specificity to ensure reliable experimental results?

Thorough validation of antibody specificity is critical for generating reliable data with MTNR1B antibodies:

• Pre-adsorption/Blocking Peptide Controls:

  • Pre-incubate the antibody with a specific blocking peptide (e.g., Melatonin Receptor 1B/MTNR1B Blocking Peptide, BLP-MR032)

  • Run parallel experiments with blocked and unblocked antibody

  • Specific signals should be absent or significantly reduced in the blocked condition

  • This approach has been successfully used for Western blot analysis of mouse and rat brain lysates

• Genetic Validation Approaches:

  • RNAi Knockdown: Validates antibody specificity by showing reduced signal after target knockdown

    • Example: pshRNA-2 plasmid effectively silenced MTNR1B mRNA by 68% and also reduced protein levels, confirming antibody specificity

  • Knockout Models: Tissues from knockout animals provide the gold standard negative control (though not mentioned in the search results)

• Multiple Antibody Validation:

  • Use antibodies targeting different epitopes of MTNR1B

  • Concordant results with different antibodies increase confidence in specificity

  • Example epitopes:

    • Extracellular domain

    • Internal region (amino acids 232-246 of mouse MTNR1B, 3rd intracellular loop)

    • C-terminal region (e.g., C-QDASKGSHAEGLQSP)

• Cross-Reactivity Assessment:

  • Test for potential cross-reactivity with MTNR1A, the other melatonin receptor

  • Some tissues express both receptors at nearly equal levels, necessitating careful specificity validation

  • Western blots should include MTNR1A controls when evaluating MTNR1B antibodies

• Correlation with mRNA Expression:

  • Compare protein detection with mRNA expression data

  • Quantitative RT-PCR (Taqman®) has been used to confirm MTNR1B expression in human islets and clonal β-cells

• Anticipated Results for Validation:

  • Western blot: Single specific band at ~40-48 kDa that disappears with blocking peptide

  • IHC: Specific staining in known positive tissues (brain, retina) that is absent with blocking peptide or in negative control tissues

Proper validation not only ensures experimental reliability but also helps resolve contradictions in the literature, such as the differing reports about cellular localization of MTNR1B in pancreatic islets .

What are the technical considerations for using MTNR1B antibodies in functional studies of melatonin signaling?

When designing functional studies to investigate melatonin signaling via MTNR1B, several technical considerations should be addressed:

• Confirming Receptor Expression:

  • Before functional studies, verify MTNR1B expression in your experimental system

  • For cell culture models, Western blot and/or immunocytochemistry can confirm receptor presence

  • For tissue studies, immunohistochemistry can identify which specific cell types express MTNR1B

• Melatonin Treatment Conditions:

  • Concentration: Previous research has used 1,200 pg/ml melatonin in granulosa cell studies

  • Timing: Effects on apoptosis were observed 48 hours after melatonin treatment

  • Vehicle controls: Include appropriate solvent controls (melatonin is typically dissolved in ethanol or DMSO at stock concentration)

• Experimental Design for Receptor Function Studies:

  • Knockdown Approach: RNAi-mediated knockdown of MTNR1B can be achieved using targeted shRNA constructs

    • Example target sequences for bovine MTNR1B :

      • pshRNA-1: GGAACGCAGGTAACCTGTTCT (position 215 on cds)

      • pshRNA-2: GCTACTTCCTGGCCTATTTCA (position 878 on cds)

      • pshRNA-3: GGGAATACAAGAGGATCATC (position 950 on cds)

    • Transfection can be performed using Lipofectamine with Plus Reagent

    • Verify knockdown efficiency at both mRNA (real-time PCR) and protein levels (Western blot)

• Functional Readouts and Pathway Analysis:

  • Apoptosis Assessment: Flow cytometry and expression analysis of apoptosis-related genes (BCL2, BCL-XL, BAX, CASP3, TP53)

  • Cell Cycle Analysis: Flow cytometry and expression of cell cycle factors (CCND1, CCNE1, CDLN1A)

  • Signaling Pathway Analysis: MTNR1B activity is mediated by pertussis toxin-sensitive G proteins that inhibit adenylate cyclase

• Control Groups for Comprehensive Analysis:
  A comprehensive experimental design should include :

  • Negative control group (e.g., pshRNA-negative)

  • MTNR1B knockdown group (e.g., pshRNA-2)

  • MTNR1B knockdown plus melatonin group

  • Melatonin only group

• Expected Outcomes:

  • MTNR1B knockdown has been shown to significantly promote GCs apoptosis without affecting the cell cycle

  • Melatonin influences mitochondrial homeostasis and protects cell integrity and function through anti-oxidant, anti-apoptosis, and free radical scavenging activity

  • In β-cells, insulin release in response to glucose was inhibited in the presence of melatonin

These methodological considerations will help researchers design robust experiments to investigate MTNR1B function while avoiding technical pitfalls that could lead to misleading results.

How might the latest research on MTNR1B antibodies contribute to understanding type 2 diabetes pathogenesis?

Recent research utilizing MTNR1B antibodies has provided important insights into the receptor's role in type 2 diabetes (T2D) pathogenesis:

• Cellular Localization Refinement:
  Immunocytochemistry using validated MTNR1B antibodies has demonstrated that the receptor is predominantly expressed in β-cells in human islets, contradicting previous reports suggesting primary localization in α-cells . This refined understanding has important implications for melatonin's role in insulin secretion regulation.

• Expression Level Correlation with Disease Risk:
  Using immunohistochemical techniques, researchers have found that non-diabetic individuals carrying T2D risk alleles and patients with established T2D showed increased expression of MTNR1B in islets . This suggests that altered receptor expression levels may be a mechanistic link between genetic predisposition and disease development.

• Functional Impact on Insulin Secretion:
  Studies combining MTNR1B antibody-based expression validation with functional assays have shown that melatonin inhibits glucose-stimulated insulin release from clonal β-cells . This direct functional evidence connects melatonin signaling to impaired insulin secretion, a hallmark of T2D.

• Temporal Dynamics of β-cell Function:
  Research has demonstrated that risk genotypes of MTNR1B SNPs are associated with impairment of early insulin response to both oral and intravenous glucose, and with faster deterioration of insulin secretion over time . MTNR1B antibodies help verify protein expression in these genetically stratified populations.

• Integrative Understanding of Circadian-Metabolic Crosstalk:
  By validating MTNR1B expression in both brain and pancreatic tissues, antibody-based studies contribute to our understanding of how the circulating hormone melatonin, predominantly released from the pineal gland, influences peripheral metabolic tissues and contributes to T2D pathogenesis .

These findings suggest potential therapeutic approaches targeting melatonin-MTNR1B signaling in T2D prevention or management, particularly for individuals with genetic risk variants in this pathway.

What emerging multiplex antibody applications show promise for MTNR1B research?

Advanced multiplex applications are expanding the research potential of MTNR1B antibodies:

• Multi-Receptor Profiling in Neural Circuits:
  Recent work has demonstrated successful co-immunostaining of MTNR1B with other receptors, particularly Angiotensin II Receptor Type-2, showing considerable co-localization in the paraventricular nucleus . This approach reveals potential receptor interactions and signaling integration in neuroendocrine circuits.

• Receptor-Channel Co-localization:
  Studies have successfully used MTNR1B antibodies in conjunction with ion channel antibodies (e.g., Nav1.2) to demonstrate partial co-localization in specific brain regions like the paraventricular nucleus . This technique helps elucidate how melatonin signaling may modulate neuronal excitability.

• Three-Dimensional Tissue Imaging:
  While not explicitly mentioned in the search results, advances in 3D imaging techniques such as tissue clearing combined with MTNR1B antibody labeling could provide more comprehensive spatial information about receptor distribution across intact tissues.

• Single-Cell Phenotyping:
  Combining MTNR1B antibody staining with other cell-type markers can enable detailed characterization of receptor expression at the single-cell level, potentially resolving controversies about cell-type specific expression patterns .

• Temporal Expression Dynamics:
  Sequential sampling and staining approaches can track MTNR1B expression changes over time (e.g., circadian variations, disease progression), particularly when combined with genetic markers or functional readouts.

These multiplex approaches provide a more integrated view of MTNR1B function within complex physiological systems, potentially revealing new therapeutic targets or biomarkers for melatonin-associated disorders.

What are common challenges in Western blot detection of MTNR1B and how can they be addressed?

Researchers frequently encounter several challenges when performing Western blot analysis for MTNR1B:

• Multiple Band Detection and Size Discrepancies:

  • Problem: Western blots often show bands at ~48 kDa and 37 kDa, despite the calculated size of 40.2 kDa

  • Solutions:

    • Verify specificity with blocking peptide controls (e.g., BLP-MR032)

    • Consider receptor glycosylation or other post-translational modifications

    • Optimize sample preparation to reduce protein degradation

    • Use gradient gels to improve separation in the 35-50 kDa range

• Weak Signal Detection:

  • Problem: Low endogenous expression can result in weak signals

  • Solutions:

    • Increase protein loading (up to 30 μg per lane has been successful)

    • Extend primary antibody incubation to overnight at 4°C

    • Use more sensitive ECL substrates

    • Consider signal amplification systems

    • Optimize antibody concentration (e.g., 1:200 to 1:400 depending on the antibody)

• Background and Non-specific Binding:

  • Problem: High background can obscure specific signals

  • Solutions:

    • Increase blocking time (>1 hour with 5% skim milk in TBST)

    • More extensive washing steps with TBST (at least three 5-minute washes)

    • Dilute primary antibody further if background persists

    • Try alternative blocking agents (BSA, commercial blockers)

• Cross-reactivity with MTNR1A:

  • Problem: Some antibodies may cross-react with the related MTNR1A receptor

  • Solutions:

    • Include MTNR1A controls in your experiment

    • Use antibodies targeting unique regions of MTNR1B

    • Verify with genetic approaches (MTNR1B knockdown should not affect MTNR1A bands)

• Sample Preparation Issues:

  • Problem: Membrane proteins like MTNR1B can be difficult to extract and maintain

  • Solutions:

    • Use specialized membrane protein extraction buffers

    • Avoid excessive heating of samples (denature at 100°C for maximum 5 minutes)

    • Include protease inhibitors in all buffers

    • Store extracted proteins at -80°C until use

Following these troubleshooting steps will help researchers obtain clearer, more specific Western blot results for MTNR1B detection.

How can researchers optimize immunohistochemical protocols for different tissue types when studying MTNR1B?

Optimization strategies for immunohistochemical detection of MTNR1B vary by tissue type:

• Brain Tissue Optimization:

  • FFPE Sections:

    • Optimal antibody concentration: 10 μg/ml for ab219615

    • Antigen retrieval: Heat-mediated antigen retrieval with citrate buffer

    • Background reduction: Use species-appropriate blocking sera

  • Frozen Sections:

    • Optimal dilution: 1:600 for AMR-032

    • Preservation method: Perfusion fixation produces better results than immersion fixation

    • Specific structures: Discrete expression has been observed in supraoptic nucleus and paraventricular nucleus

• Retinal Tissue:

  • Higher antibody concentrations may be needed due to complex tissue architecture

  • Background reduction is particularly important due to autofluorescence

  • Abcam ab219615 has been successfully used at 10 μg/ml

  • Consider tyramide signal amplification for low expression levels

• Pancreatic Islets:

  • Critical for diabetes research applications

  • Requires careful fixation to preserve antigenicity

  • Co-staining with islet cell markers (insulin for β-cells, glucagon for α-cells) aids in precise localization

  • Extended blocking steps help reduce background in this often autofluorescent tissue

• Skin and Melanoma Tissue:

  • Successfully stained with ab219615 at 10 μg/ml

  • May require melanin bleaching steps to reduce background in pigmented tissues

  • Extended antibody incubation times may improve penetration

• Universal Optimization Strategies:

  • Antibody Titration: Always perform a dilution series to determine optimal concentration

  • Antigen Retrieval Comparison: Compare citrate buffer (pH 6) vs. EDTA buffer (pH 9)

  • Detection System Selection:

    • Chromogenic systems: AP-staining has worked well for human cerebellum

    • Fluorescence: Select fluorophores that avoid tissue autofluorescence wavelengths

  • Control Slides:

    • Negative controls: Primary antibody omission and blocking peptide pre-adsorption

    • Positive controls: Include tissues with known MTNR1B expression (cerebellum for human samples)

Each tissue type presents unique challenges for MTNR1B detection, requiring systematic optimization of multiple protocol parameters for optimal results.