MRTO4 Human

What is MRTO4 and what is its primary function in human cells?

MRTO4 is a trans-acting factor involved in ribosome biogenesis, located on human chromosome 17q25.3 . It contains a C-terminal extension similar to the C-terminal part of ribosomal P proteins, which is significant for its cellular function . The protein plays a critical role in ribosome maturation, a fundamental process required for protein synthesis and cellular homeostasis .

Methodological approach for studying MRTO4's function:

• Expression and purification of recombinant MRTO4

• Ribosome profiling and polysome analysis

• Co-immunoprecipitation to identify interaction partners

• Subcellular localization studies using fluorescence microscopy

How is MRTO4 expressed in normal human tissues versus cancer tissues?

MRTO4 is significantly overexpressed in various tumors, including HCC, compared to normal tissues . Analyses from The Cancer Genome Atlas (TCGA) database and Gene Expression Omnibus (GEO) datasets (GSE121248 and GSE45267) have confirmed elevated expression of MRTO4 in HCC tissues compared to adjacent normal tissues .

Experimental approach:

• RT-qPCR using primers specific for MRTO4 (Forward: TGGCCAACATGAGGAACAGC, Reverse: TTCATCAGATGGGCTCCGAC)

• Immunohistochemistry of tissue microarrays

• Western blotting with MRTO4-specific antibodies

• Analysis of public databases (TCGA, GEO) for expression patterns

What post-translational modifications affect MRTO4 function?

Human MRTO4 undergoes phosphorylation in vivo. Specifically, serines S229, S233, and S235, located within its acidic C-termini, have been identified as targets of phosphorylation by CK2 kinase in vitro . These modifications don't alter MRTO4's subcellular distribution under standard conditions but significantly affect its molecular behavior during ActD-induced nucleolar stress .

Methods for studying MRTO4 phosphorylation:

• In vitro kinase assays with purified CK2

• Phospho-specific antibodies

• Mass spectrometry analysis of phosphorylation sites

• Site-directed mutagenesis of target serines to alanines or phosphomimetic residues

How does MRTO4 promote glycolysis in HCC cells and what is its relationship with ALDOB?

MRTO4 enhances glycolysis in HCC cells primarily through the inhibition of ALDOB (Aldolase B) . This inhibition leads to metabolic reprogramming that favors glycolysis, a hallmark of cancer metabolism often referred to as the Warburg effect. The enhanced glycolysis driven by MRTO4 supports rapid cancer cell proliferation, invasion, and suppresses apoptosis in HCC cells .

Experimental design for studying MRTO4-mediated glycolysis:

• Measurement of glycolytic parameters (glucose uptake, lactate production, extracellular acidification rate)

• Expression analysis of glycolytic enzymes

• ALDOB activity assays after MRTO4 modulation

• Co-immunoprecipitation to confirm MRTO4-ALDOB interaction

• Chromatin immunoprecipitation to identify potential transcriptional regulation

What is the prognostic value of MRTO4 expression in HCC and how was this determined?

• Kaplan-Meier survival analysis of TCGA data

• Univariate and multivariate Cox regression analyses

• Construction of nomograms for predicting HCC survival

• ROC curve analysis to evaluate diagnostic performance

The table below shows the correlation between MRTO4 expression and clinical characteristics in HCC patients:

Data from TCGA database analysis

How does MRTO4 expression influence the tumor microenvironment and immune infiltration in HCC?

MRTO4 expression correlates significantly with immune cell infiltration in the tumor microenvironment (TME) . Studies show that:

• TME scores (stromal scores, immune scores, and ESTIMATE scores) were significantly higher in the low MRTO4 group compared to the high MRTO4 group in HCC .

• The average immunophenoscore (IPS) of the low MRTO4 group was significantly higher than that of the high MRTO4 group .

• MRTO4 expression is positively correlated with tumor mutation burden (TMB) .

• MRTO4 expression shows positive correlation with most immune checkpoint gene expressions in HCC .

Methodological approaches:

• Single-sample Gene Set Enrichment Analysis (ssGSEA)

• CIBERSORT for immune cell deconvolution

• Spearman's correlation coefficient analysis

• Analysis of immune checkpoint gene expression

What experimental models have proven most effective for studying MRTO4 function in cancer research?

Researchers have successfully employed multiple experimental models to investigate MRTO4 function:

• In vitro cell models:

  • HCC cell lines (HepG2, MHCC97H)

  • Transfection with siRNA (si-MRTO4) or overexpression vectors (OE-MRTO4)

  • Functional assays: CCK8, TUNEL, clone formation, Transwell assay

• In vivo models:

  • BALB/c nude mice (aged 5-8 weeks, weighing 18-20g)

  • Orthotopic injection of 2.0×10^6 MHCC-97H cells into the left hepatic lobe

  • Tumor growth measurement every 5 days for 21 days

  • Analysis of tumor mass, volume, and weight

• Bioinformatics approaches:

  • Analysis of data from TCGA, GEO, TCIA, and THPA databases

  • Protein-protein interaction network analysis using STRING database

  • Functional enrichment analysis (GO, KEGG)

  • Immune infiltration analysis

How does MRTO4 expression affect drug sensitivity in HCC, and what are the implications for therapy?

Drug sensitivity analysis shows significantly higher IC50 values for several chemotherapeutic agents in patients with low MRTO4 expression compared to those with high MRTO4 expression . Specifically:

• 5-fluorouracil: Lower sensitivity in low MRTO4 expression group

• Gemcitabine: Lower sensitivity in low MRTO4 expression group

• Sorafenib: Lower sensitivity in low MRTO4 expression group

This suggests MRTO4 expression levels could serve as a biomarker for predicting treatment response in HCC patients .

Methodological approach for drug sensitivity studies:

• pRRophetic R package for predicting IC50 values

• Cell viability assays after drug treatment in MRTO4-manipulated cells

• Combination therapy experiments

• Analysis of apoptotic markers and cell cycle progression

What approaches can be used to target MRTO4 therapeutically in HCC?

Given MRTO4's role in promoting HCC progression, several therapeutic approaches could be considered:

• RNA interference strategies:

  • siRNA targeting MRTO4 (as demonstrated in the research with si-MRTO4)

  • shRNA for stable knockdown

  • Antisense oligonucleotides

• Small molecule inhibitors:

  • Targeting MRTO4's interaction with ALDOB

  • Inhibiting MRTO4's phosphorylation by CK2 kinase

• Combination therapies:

  • MRTO4 inhibition combined with glycolysis inhibitors

  • MRTO4 targeting alongside conventional chemotherapeutics

Experimental approaches for validation:

• In vitro efficacy studies in HCC cell lines

• In vivo tumor models with MRTO4 inhibition

• Pharmacokinetic and pharmacodynamic analyses

• Assessment of glycolytic parameters after treatment

How can the conflicting roles of MRTO4 in ribosome biogenesis versus cancer progression be reconciled in therapeutic development?

MRTO4 has an essential role in normal ribosome biogenesis , yet its overexpression promotes cancer progression . This dual functionality presents a challenge for therapeutic targeting.

Approaches to address this conflict:

• Therapeutic window exploration:

  • Determine differential expression levels between normal and cancer cells

  • Identify cancer-specific vulnerabilities related to MRTO4 overexpression

• Targeting cancer-specific interactions:

  • Focus on MRTO4-ALDOB interaction in cancer cells

  • Target post-translational modifications specific to cancer contexts

• Conditional targeting strategies:

  • Cancer-specific promoters for gene therapy approaches

  • Tumor microenvironment-responsive drug delivery systems

• Synthetic lethality approaches:

  • Identify genes that, when inhibited alongside MRTO4, cause selective cancer cell death

What are the most reliable primers and antibodies for studying MRTO4 expression and function?

Based on published research, the following have proven effective:

RT-qPCR primers for MRTO4:

• Forward: TGGCCAACATGAGGAACAGC

• Reverse: TTCATCAGATGGGCTCCGAC

Control gene primers (GAPDH):

• Forward: AGAAGGCTGGGGCTCATTTG

• Reverse: CAGGGGTGCTAAGCAGTTGG

Antibodies:
While specific antibodies were not detailed in the search results, researchers typically use:

• Anti-MRTO4 antibodies for Western blotting and immunohistochemistry

• Phospho-specific antibodies for detecting MRTO4 phosphorylation states

• Tagged recombinant MRTO4 (with FLAG, HA, or GFP tags) for localization studies

How can researchers effectively analyze MRTO4's role in altering metabolic profiles in cancer cells?

To comprehensively analyze MRTO4's impact on cancer cell metabolism:

• Glycolytic pathway analysis:

  • Measure glucose uptake using fluorescent glucose analogs

  • Quantify lactate production with colorimetric or enzymatic assays

  • Assess extracellular acidification rate (ECAR) using Seahorse XF analyzer

  • Measure expression and activity of key glycolytic enzymes

• Metabolomics approaches:

  • Untargeted metabolomics to identify broader metabolic changes

  • Targeted analysis of glycolytic intermediates

  • Stable isotope tracing to track carbon flow through metabolic pathways

• Energy metabolism assessment:

  • Oxygen consumption rate (OCR) measurement

  • ATP production assays

  • Analysis of mitochondrial function

• Integration with functional assays:

  • Correlate metabolic changes with proliferation, invasion, and survival phenotypes

  • Use metabolic inhibitors to rescue MRTO4-induced phenotypes

What bioinformatic pipelines are most effective for analyzing MRTO4 across multiple cancer datasets?

Based on the research, effective bioinformatic approaches include:

• Expression analysis across cancer types:

  • Retrieval of mRNA expression data from TCGA, GEO, and other databases

  • Differential expression analysis between tumor and normal tissues

  • Expression correlation with clinical parameters

• Survival analysis:

  • Kaplan-Meier curves using the 'survival' package in R

  • Univariate and multivariate Cox regression analysis

  • Construction of predictive nomograms with the 'rms' R package

• Functional analysis:

  • Gene Ontology (GO) enrichment analysis

  • Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis

  • Protein-Protein Interaction (PPI) network construction using STRING database and visualization with Cytoscape 3.9.1

• Immune and microenvironment analysis:

  • ESTIMATE algorithm for stromal and immune scores

  • ssGSEA for immune cell infiltration analysis

  • CIBERSORT for detailed immune cell type evaluation

• Drug sensitivity prediction:

  • pRRophetic R package for predicting IC50 values of different drugs

What are the emerging roles of MRTO4 beyond ribosome biogenesis and cancer metabolism?

While MRTO4's roles in ribosome biogenesis and cancer metabolism are established, several emerging areas warrant investigation:

• Stress response pathways:

  • Phosphorylation affects MRTO4's behavior during nucleolar stress

  • Potential roles in other cellular stress responses

• Immune regulation:

  • Correlation with immune checkpoint gene expression

  • Potential direct or indirect effects on immune cell function

• Post-transcriptional regulation:

  • Possible roles in RNA processing or stability

  • Interactions with non-coding RNAs

Methodological approaches for exploring these roles:

• RNA-seq and CLIP-seq analyses

• Proximity labeling proteomics

• Single-cell transcriptomics under various stress conditions

• Immune cell co-culture systems

How might contradictions in MRTO4 research findings be resolved through improved experimental design?

Researchers may encounter contradictory findings regarding MRTO4 function. These contradictions can be addressed through:

• Cell type-specific analyses:

  • Compare MRTO4 function across different cell types and cancer subtypes

  • Determine context-dependent effects

• Temporal dynamics studies:

  • Analyze MRTO4 function at different time points

  • Use inducible systems for temporal control of MRTO4 expression

• Dose-dependent effects evaluation:

  • Study effects of varying levels of MRTO4 overexpression or knockdown

  • Determine thresholds for different cellular responses

• In vivo validation:

  • Confirm in vitro findings in appropriate animal models

  • Use tissue-specific conditional knockout models

• Multi-omics integration:

  • Combine transcriptomics, proteomics, and metabolomics data

  • Use systems biology approaches to model complex interactions

What novel technologies might advance our understanding of MRTO4 function in human disease?

Several cutting-edge technologies could significantly enhance MRTO4 research:

• CRISPR-based technologies:

  • CRISPR activation/interference for precise modulation of MRTO4 expression

  • Base editing for introducing specific mutations

  • CRISPR screens to identify synthetic lethal interactions

• Advanced imaging techniques:

  • Super-resolution microscopy for detailed localization studies

  • Live-cell imaging to track MRTO4 dynamics

  • FRET/BRET for studying protein-protein interactions in real-time

• Single-cell technologies:

  • Single-cell RNA-seq to capture heterogeneity in MRTO4 expression

  • Single-cell proteomics for protein-level analysis

  • Spatial transcriptomics to understand tissue context

• Organoid models:

  • Patient-derived organoids for personalized MRTO4 studies

  • Co-culture systems with immune cells to study microenvironment interactions

• AI and machine learning approaches:

  • Prediction of MRTO4 interaction networks

  • Identification of novel therapeutic targets in MRTO4-related pathways

  • Integration of multi-omics data for comprehensive understanding