The At5g38100 Antibody is a specialized immunological reagent designed to target the protein product of the At5g38100 gene in Arabidopsis thaliana (mouse-ear cress). This gene encodes a probable S-adenosylmethionine (SAM)-dependent methyltransferase, which plays a role in biochemical processes such as methylation-dependent regulation of plant metabolism and stress responses . The antibody is utilized in molecular and cellular studies to investigate the expression, localization, and functional roles of the At5g38100 protein.
Gene ID: At5g38100 (Arabidopsis thaliana)
Protein Function: SAM-dependent methyltransferases are critical for transferring methyl groups to substrates, influencing processes like epigenetic regulation, secondary metabolite synthesis, and stress adaptation .
At5g38100 is implicated in glycoalkaloid and flavonoid biosynthesis pathways. In transcriptomic analyses of diploid potato, homologs of At5g38100 were upregulated in phytotoxic genotypes, suggesting a role in stress-related metabolic adjustments (Table 1) .
| Locus | Log2FC (A’ vs. F’) | p-Value | Function |
|---|---|---|---|
| LOC102591096 | 5.97 | 4.58 × 10⁻⁶ | Probable SAM-dependent methyltransferase |
While direct validation data for the At5g38100 Antibody is limited, analogous antibodies (e.g., ATG5 Antibody ) are validated for applications such as:
The At5g38100 Antibody shares technical similarities with other plant-targeting antibodies, such as those against ATG5 or histone demethylases . Key distinctions include:
The At5g38100 Antibody could be pivotal in studies exploring:
At5g38100 is a gene locus in Arabidopsis thaliana that encodes a SABATH family methyltransferase . This protein family is involved in various methylation reactions in plants, potentially affecting metabolic processes and stress responses. Understanding its function requires reliable antibody-based detection methods to investigate protein expression, localization, and interactions in different plant tissues and under various conditions.
For optimal antibody binding to At5g38100 in plant tissues, researchers should:
Use extraction buffers specifically designed for plant tissues that maintain protein integrity while effectively solubilizing membrane-associated proteins
Include protease inhibitors to prevent protein degradation during extraction
Consider using specialized extraction protocols for different plant organs (roots, leaves, stems) as protein accessibility may vary
Optimize fixation conditions (4% paraformaldehyde for 5 minutes is often effective)
Test multiple antigen retrieval methods if working with fixed tissues
Fresh tissue extraction generally yields better results than fixed tissues for Western blotting applications, while proper fixation is critical for immunohistochemistry.
To determine antibody specificity for At5g38100:
Perform Western blot analysis comparing wild-type plants with At5g38100 knockout/knockdown lines
Conduct immunoprecipitation followed by mass spectrometry (IP-MS) to identify all proteins pulled down by the antibody
Use peptide competition assays with the immunizing peptide to block specific binding
Compare staining patterns from multiple independent antibodies targeting different epitopes of At5g38100
Implement RNA interference for target validation in conjunction with antibody-based detection
These validation steps are essential as demonstrated in recent studies where antibodies like anti-GR clone 5E4 showed unexpected cross-reactivity with unrelated proteins (AMPD2 and TRIM28) .
Cross-reactivity validation requires systematic analysis:
Perform sequence alignment of At5g38100 with homologous proteins across plant species to identify conserved regions
Test antibody reactivity against recombinant proteins from different species using ELISA or Western blot
Consider epitope mapping to identify the specific binding region
Use tissue from multiple plant species in parallel experiments with appropriate controls
Perform immunoprecipitation followed by mass spectrometry across species to identify all captured proteins
For example, antibodies like AS12 2119 have demonstrated cross-reactivity across multiple plant species including A. thaliana, N. tabacum, and O. sativa , suggesting proper validation methods can identify antibodies suitable for comparative studies.
Optimizing immunoprecipitation of At5g38100 requires attention to multiple factors:
| Parameter | Recommended Approach | Rationale |
|---|---|---|
| Lysis Buffer | Use plant-specific extraction buffers with mild detergents | Preserves protein-protein interactions while solubilizing membrane proteins |
| Antibody Amount | Titrate from 1-10 μg per sample | Determine minimum effective concentration for specific binding |
| Incubation Time | Test both short (2h) and overnight incubation at 4°C | Balance between binding efficiency and nonspecific interactions |
| Washing Stringency | Perform serial washes with increasing salt concentration | Removes nonspecific binding while preserving target interactions |
| Elution Method | Compare acid elution vs. competitive peptide elution | Different methods may yield varying purity and recovery |
Research has shown that proper optimization of these parameters significantly improves specificity, as demonstrated in studies identifying unexpected antibody targets using immunoprecipitation followed by mass spectrometry .
Post-translational modifications (PTMs) can significantly impact antibody recognition of At5g38100:
Phosphorylation, glycosylation, or other PTMs may mask epitopes or create new conformational structures
Some antibodies may preferentially recognize modified or unmodified forms of the protein
Treatment conditions (stress, hormone application) may alter PTM profiles, changing antibody reactivity
For glycosylated epitopes, testing with deglycosylated protein extracts (using enzymes like PNGase F) can determine if glycosylation affects antibody binding
Research has shown that glycosylation is not always required for antibody immunoreactivity, as demonstrated in immunoabsorption experiments with glycosylated versus deglycosylated protein extracts .
Essential controls for At5g38100 antibody experiments include:
Genetic controls: Include At5g38100 knockout/knockdown lines and overexpression lines
Antibody controls:
Secondary antibody-only control to detect nonspecific binding
Isotype control antibodies to identify Fc receptor binding
Preimmune serum control (for polyclonal antibodies)
Peptide competition: Pre-incubation with immunizing peptide should abolish specific signals
Multiple antibody validation: Use independent antibodies targeting different epitopes of At5g38100
Cross-species validation: If claiming cross-reactivity, verify signal in each species
Implementation of these controls is crucial, as illustrated in studies demonstrating that even well-established antibodies like anti-GR (5E4) can show unexpected cross-reactivity .
Distinguishing nonspecific binding from low-abundance expression requires multiple complementary approaches:
Implement RNA interference or CRISPR knockout of At5g38100 using validated sequences such as:
| shRNA ID | Target Sequence | Validation Method |
|---|---|---|
| sh1 | AAGCTTTCCTGGAGCAAATAT | Western blot + qPCR |
| sh2 | CAGACTCAACTTGGAGGATCA | Western blot + qPCR |
| sh3 | CTGCATGTACGACCAATGTAA | Western blot + qPCR |
Use orthogonal detection methods (RNA-seq, RT-PCR) to correlate protein detection with transcript abundance
Increase sensitivity through signal amplification methods while maintaining rigorous controls
Perform fractionation to enrich for membrane, cytosolic, or nuclear proteins before antibody application
Compare results from different antibody clones targeting different epitopes of At5g38100
Research has shown that orthogonal validation methods are essential for confirming antibody specificity, particularly when working with low-abundance proteins .
Optimizing At5g38100 antibodies for live-cell imaging requires:
Antibody format selection:
Consider using smaller fragments (Fab, scFv) that penetrate tissues more effectively
Test directly labeled primary antibodies to avoid secondary antibody steps
Validate that fluorophore conjugation doesn't impair epitope recognition
Delivery methods:
Microinjection or biolistic delivery for intact tissues
Protoplast preparation for single-cell studies
Careful optimization of permeabilization conditions to maintain cell viability
Signal verification:
Compare patterns with fixed-tissue immunohistochemistry results
Correlate with fluorescent protein fusion localization data
Perform FRAP (Fluorescence Recovery After Photobleaching) to assess antibody binding dynamics
Studies involving plasma B cells have successfully used similar approaches for capturing single cells and their secretions in specialized nanovial containers, which could be adapted for plant cell applications .
Resolving contradictory results requires systematic investigation:
Epitope mapping:
Determine the specific binding sites of each antibody
Assess whether epitopes might be differentially accessible in various experimental conditions
Consider whether post-translational modifications might affect epitope availability
Comprehensive validation:
Contextual analysis:
Evaluate whether discrepancies occur in specific tissues, developmental stages, or stress conditions
Consider whether protein conformation differs in various cellular compartments
Assess whether protein-protein interactions might mask epitopes in certain contexts
Research has demonstrated that even well-established antibody clones can show unexpected cross-reactivity with unrelated proteins, necessitating rigorous validation .
Developing a quantitative immunoassay involves:
Antibody pair selection:
Assay format optimization:
Compare sandwich ELISA, competitive ELISA, and bead-based multiplex formats
Determine optimal coating concentrations, blocking conditions, and detection methods
Establish standard curves using recombinant At5g38100 protein
Validation across samples:
Test assay performance across diverse plant tissues and growth conditions
Validate results against orthogonal methods (Western blot, mass spectrometry)
Ensure consistent performance across multiple protein extraction methods
Data analysis:
Establish limits of detection and quantification
Determine intra- and inter-assay coefficients of variation
Validate dynamic range appropriate for biological variation in At5g38100 levels
Development of such assays has been successful for other proteins, such as DEFA5, where carefully selected antibody pairs achieved high specificity and sensitivity for diagnostic applications .
When facing weak or absent signals:
Sample preparation optimization:
Test multiple protein extraction methods specifically designed for plant tissues
Consider tissue-specific extraction protocols that account for cell wall components
Optimize fixation and antigen retrieval protocols for immunohistochemistry
Antibody binding enhancement:
Test different blocking reagents (BSA, milk, plant-specific blockers)
Optimize antibody concentration and incubation conditions
Consider signal amplification methods (tyramide signal amplification, polymer detection systems)
Target protein considerations:
Assess whether the target may be degraded during sample preparation
Consider developmental regulation or tissue-specific expression patterns
Evaluate whether stress conditions might induce or suppress expression
Technical verification:
Confirm antibody functionality using recombinant At5g38100 protein
Test positive control samples where the protein is known to be expressed
Consider epitope masking due to protein-protein interactions or post-translational modifications
Research has shown that optimizing these parameters can significantly improve detection sensitivity, as demonstrated in studies using nanovials to capture single cells and their secretions .
To distinguish between antibody and biological variability:
Antibody characterization:
Standardization approaches:
Include consistent positive controls across experiments
Use recombinant protein standards at known concentrations
Implement normalization strategies using housekeeping proteins
Systematic validation:
Document all experimental variables (extraction method, antibody lot, incubation conditions)
Perform spike-in experiments with recombinant protein
Consider epitope mapping to understand potential batch-to-batch variations in polyclonal antibodies
Studies have demonstrated that antibody batch effects can be identified by performing replicate experiments with antibodies from different manufacturers, followed by verification using orthogonal methods such as mass spectrometry .