Mug174 (Meiosis-upregulated gene 174) is a Schizosaccharomyces pombe protein essential for Cajal body-like nuclear condensates. These structures facilitate critical processes such as pre-mRNA splicing, snRNP assembly, and cellular quiescence . Mug174 shares weak homology with human Coilin and colocalizes with it when expressed in fission yeast .
Mug174 exhibits phase-separation properties in vitro and interacts with trimethylguanosine (TMG) synthase Tgs1 and U snRNAs . Key functions include:
Pre-mRNA Splicing: Mug174 deletion disrupts spliceosome assembly and TMG capping of U snRNAs .
Chromosome Segregation: mug174Δ mutants show lagging chromosomes during anaphase, linked to defective spindle dynamics .
Cellular Quiescence: Mug174 is indispensable for maintaining and exiting quiescent states, a process disrupted in its absence .
Deletion of mug174+ causes pleiotropic defects:
While no Mug174-specific antibody is documented, studies utilize epitope-tagged Mug174 (e.g., GFP, mCherry) and antibodies against these tags:
Anti-GFP: Detects Mug174-GFP fusion proteins in fluorescence microscopy and Western blotting .
Anti-mCherry: Localizes Mug174 relative to nucleolar (Gar2) or cleavage body (Red1) markers .
Anti-His: Identifies recombinant Mug174-6×His in in vitro droplet assays .
Mug174’s role in Cajal body function and quiescence provides insights into diseases linked to Coilin dysfunction, such as neurodegenerative disorders and cancer . Conservation of Coilin across species suggests shared mechanisms in snRNP biogenesis and stress response .
KEGG: spo:SPCC1682.03c
Mug174 is the ortholog of Coilin in fission yeast (Schizosaccharomyces pombe), serving as an integral component in the formation of Cajal body-like nuclear condensates. These nuclear bodies are crucial for ribonucleoprotein assembly, including small nuclear RNPs (snRNPs). The significance of studying mug174 stems from its essential role in cellular quiescence, RNA processing, and its potential implications for understanding human diseases related to Cajal body dysfunction . Researchers typically employ antibodies against mug174 to track its localization, interaction partners, and functional changes under various cellular conditions.
While only weak homology exists between Mug174 and human Coilin at the sequence level, they share remarkable functional similarities. Both proteins form nuclear condensates and interact with RNA processing machinery. Notably, when human Coilin is expressed in fission yeast, it colocalizes with Mug174, suggesting conserved functional domains despite sequence divergence . When designing or selecting antibodies for cross-reactivity studies, researchers should focus on conserved functional domains rather than sequence identity.
Mug174 participates in multiple essential cellular processes:
Pre-mRNA splicing (facilitates removal of introns)
U snRNA trimethylguanosine (TMG) capping via interaction with Tgs1
Maintenance of centromeric heterochromatin
Proper chromosome segregation during mitosis
Regulation of gene expression (affects both transcriptome and proteome)
Essential for meiotic progression and sporulation
Understanding these diverse functions requires specialized antibody applications including ChIP, co-immunoprecipitation, and immunofluorescence microscopy with carefully optimized protocols.
For optimal immunofluorescence detection of mug174:
Fixation protocol: Use 3.7% formaldehyde for 30 minutes at room temperature to preserve nuclear architecture while maintaining antibody epitope accessibility.
Permeabilization: Treat with 1% Triton X-100 for 5 minutes to allow antibody penetration while preserving nuclear condensates.
Antibody dilution: Start with 1:500 dilution and optimize based on signal-to-noise ratio.
Controls: Always include a mug174Δ strain as a negative control to confirm specificity.
Co-staining recommendation: Use markers for nucleolus (e.g., anti-Fib1) to confirm the relationship between mug174 foci and nucleolar structures .
When analyzing images, note that mug174 forms distinct foci often associated with the nucleolus and cleavage body, and the number of these foci increases in tgs1Δ strains .
Based on successful co-IP experiments demonstrating the interaction between mug174 and Tgs1 , the following protocol is recommended:
Cell lysis buffer: Use 50mM HEPES pH 7.5, 150mM NaCl, 0.5% NP-40, 1mM EDTA with protease inhibitors.
Pre-clearing: Incubate lysate with protein A/G beads for 1 hour at 4°C.
Antibody binding: Incubate pre-cleared lysate with anti-mug174 antibody (2-5μg) overnight at 4°C.
Washing stringency: Perform 5 washes with buffer containing 300mM NaCl to reduce non-specific interactions.
Elution method: Use 0.1M glycine (pH 2.5) followed by immediate neutralization.
When investigating RNA-protein interactions, include RNase inhibitors in all buffers and consider crosslinking before lysis to preserve transient interactions .
For effective ChIP-qPCR experiments investigating mug174's role in chromatin regulation:
Crosslinking conditions: 1% formaldehyde for 15 minutes at room temperature.
Sonication parameters: Optimize to achieve DNA fragments of 200-500bp.
Antibody amount: Use 5μg of anti-mug174 antibody per 1×10^8 cells.
Target regions: Include primers for:
| Target Region | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Expected Enrichment |
|---|---|---|---|
| Centromeric dg | AATTGTGGTGGTGTGGTAATAC | CGAATCTTCACTGAGTGCATC | Moderate in WT, reduced in tgs1Δ |
| Centromeric dh | TGCAACTGTCAGCGGTATTG | GAAACACATCGTTGTCTTCAGAG | Moderate in WT, reduced in tgs1Δ |
| rDNA repeats | CGGTTTTGATTGAATGGATAGG | CGAGGTTATCTAGAGTCACC | Low in vegetative, increased in G0 |
| Control (act1) | GGTTTCGCTGGAGATGATG | ATACCACGCTTGGACTTAGC | Negligible (background) |
Include H3K9me2 ChIP as a parallel experiment to correlate mug174 binding with heterochromatin status .
The relationship between mug174 and RNA processing can be investigated using:
RNA-Immunoprecipitation (RIP): Use anti-mug174 antibodies to pull down associated RNAs, followed by RT-qPCR or sequencing to identify bound U snRNAs and other targets .
Immunoprecipitation-mass spectrometry (IP-MS): Identify proteins that co-precipitate with mug174 under different conditions (e.g., normal growth vs. stress).
Proximity-dependent biotin labeling: Fuse mug174 with BioID or APEX2 to identify proteins in close proximity within nuclear condensates.
Fluorescence microscopy with RNA FISH: Combine mug174 immunofluorescence with RNA FISH for specific U snRNAs to visualize colocalization.
Research indicates that mug174 is critical for pre-mRNA splicing, with mug174Δ cells showing accumulation of unspliced transcripts and intron reads . Particularly affected are genes containing introns, with proteome analysis showing that 66% of decreased proteins in mug174Δ cells derive from intron-containing genes .
To investigate mug174's essential role in cellular quiescence:
Time-course immunofluorescence: Track mug174 localization changes during entry into, maintenance of, and exit from G0 using fixed time points.
Live-cell imaging: Use fluorescently tagged mug174 to monitor dynamic changes during quiescence transitions.
ChIP-seq analysis: Compare mug174 and H3K9me2 chromatin association patterns between:
Viability and mitotic competence assays: Quantify these parameters in wild-type versus mug174Δ strains at multiple time points after nitrogen starvation.
Research shows that mug174 deletion causes progressive loss of viability and mitotic competence in G0 cells, with defects becoming more pronounced after 1-2 weeks in quiescence . Additionally, mug174Δ cells develop aberrant H3K9me2 accumulation at rDNA repeats during extended G0, similar to but less severe than dcr1Δ cells .
To study mug174-containing nuclear condensates:
Super-resolution microscopy: Combine anti-mug174 antibodies with structural illumination or STORM microscopy to visualize condensate fine structure.
Co-immunostaining panel: Create a systematic panel combining anti-mug174 with antibodies against:
FRAP analysis: Use fluorescently-tagged mug174 to measure dynamics of protein exchange within condensates.
In vitro reconstitution: Combine purified mug174 with interaction partners to study phase separation properties under controlled conditions.
Research demonstrates that mug174 forms phase-separated condensates in vitro and shows interdependent localization with Tgs1 in vivo . The number of mug174 foci increases in tgs1Δ cells, suggesting that U snRNP biogenesis mediated by Tgs1 is required for proper condensate integrity .
Inconsistent staining patterns may result from:
Cell cycle variation: mug174 foci persist throughout meiosis but may change in number or intensity during different cell cycle phases . Synchronize cells or use cell cycle markers as co-stains.
Fixation artifacts: Over-fixation can mask epitopes while under-fixation may disrupt condensate structure. Test multiple fixation times.
Strain background effects: Genetic background can influence nuclear organization. Include multiple strain backgrounds as controls.
Antibody batch variation: Validate each new antibody lot against known positive controls.
Technical variability: Environmental factors like temperature during fixation can affect results. Standardize all protocol steps.
| Cell Condition | Expected mug174 Pattern | Common Issues | Recommendation |
|---|---|---|---|
| Vegetative growth | Distinct nuclear foci, often nucleolar-associated | Diffuse signal | Reduce antibody concentration, optimize fixation |
| Nitrogen starvation | Foci in rounded cells | Weak signal | Increase antibody concentration, extend incubation |
| Meiotic cells | Persistent foci through meiosis | Variable patterns | Use synchronized cultures, co-stain for meiotic markers |
| G0 phase | Critical for detection of quiescence defects | Loss of signal in extended G0 | Fresh antibody, careful handling of G0 cells |
To validate a new mug174 antibody:
Western blot analysis:
Immunofluorescence validation:
Compare localization pattern with published data
Perform peptide competition assay
Test in mug174Δ strains
Functional validation:
Cross-reactivity assessment:
Remember that mug174 shows only weak homology to human Coilin, so antibodies raised against one may not necessarily recognize the other despite their functional similarity .
When studying mug174 during cellular quiescence:
Cell harvesting: Use gentle centrifugation (1000g, 3 min) to avoid damaging fragile G0 cells.
Fixation modifications: Reduce formaldehyde concentration to 2.5% and extend fixation time to 45 minutes for G0 cells with thickened cell walls.
Antibody penetration: Increase permeabilization time and consider enzymatic pre-treatment (e.g., zymolyase) to improve antibody access.
Viability markers: Include propidium iodide staining to distinguish between viable and non-viable cells in extended G0 cultures.
Time-point selection: Critical timepoints include:
Research shows that mug174 is indispensable for maintenance of cellular quiescence, with progressively worsening phenotypes (loss of viability and mitotic competence) in mug174Δ cells during extended quiescence .
Antibodies against mug174 can contribute to disease research by:
Comparative studies: Investigate the functional conservation between mug174 and human Coilin to identify conserved mechanisms relevant to Cajal body-related diseases.
Model development: Use fission yeast as a simplified model system to study fundamental Cajal body functions that may be disrupted in human diseases.
Drug screening platforms: Develop assays using mug174 antibodies to screen compounds that might restore proper Cajal body function.
Biomarker potential: Explore whether alterations in mug174/Coilin post-translational modifications could serve as disease biomarkers.
The research suggests that mug174/Cajal body dysfunction is implicated in cellular quiescence defects, potentially preventing human diseases . This connection provides a foundation for investigating how Cajal body malfunction contributes to pathological conditions.
When investigating mug174's role in heterochromatin regulation:
ChIP protocol optimization:
Use sonication conditions optimized for heterochromatic regions
Include input normalization controls specific for repetitive regions
Consider sequential ChIP to detect co-occupancy with H3K9me2
Genetic interaction studies:
Microscopy approaches:
Perform co-localization studies with heterochromatin markers
Use live-cell imaging to track dynamics at centromeres
Research shows mug174 plays a role in maintaining centromeric heterochromatin, with mug174Δ cells showing reduced H3K9me2 at centromeric dg and dh repeats and increased centromeric transcripts . Additionally, mug174Δ cells exhibit lagging chromosomes and minichromosome loss phenotypes, suggesting defects in chromosome segregation .