MYBPH Antibody

What is MYBPH and what cellular functions does it regulate?

MYBPH (also known as H-protein or MyBP-H) is a structural protein that binds to myosin and is involved in interactions with thick myofilaments in the A-band . Originally identified as an important myofibrillar constituent of vertebrate skeletal and cardiac muscles, recent research has revealed its role beyond muscle tissues . MYBPH functions as a transcriptional target of thyroid transcription factor-1 (TTF-1) and can reduce cell movement and metastasis by inhibiting Rho-associated protein kinase 1 (ROCK1) . This inhibitory action on cell migration appears to be a key mechanism underlying its biological function in both normal and pathological contexts.

What types of MYBPH antibodies are commercially available and for which applications?

Several types of MYBPH antibodies are currently available for research use:

When selecting an antibody, researchers should consider the specific application, species reactivity, and whether a monoclonal or polyclonal antibody better suits their experimental needs.

How should MYBPH antibodies be stored and handled to maintain optimal activity?

For optimal antibody performance, proper storage and handling are essential:

• Store MYBPH antibodies at 4°C in the dark to preserve activity, particularly for fluorophore-conjugated antibodies like the Janelia Fluor 549 variant

• Include preservatives such as 0.05% sodium azide to prevent microbial contamination during storage

• Avoid repeated freeze-thaw cycles which can degrade antibody quality

• Follow manufacturer's recommendations for specific formulations (e.g., 50mM Sodium Borate buffer is used for some preparations)

• When working with the antibody, maintain cold chain until ready for use

• Prepare working dilutions immediately before experiments rather than storing diluted antibody solutions

What validation methods should be used to confirm MYBPH antibody specificity?

Rigorous validation is critical for ensuring experimental reproducibility with MYBPH antibodies:

• Western blot validation: Compare bands from control cells versus MYBPH-overexpressing cells (e.g., HEK-293T cells transfected with pCMV6-ENTRY MYBPH construct) . Look for the predicted band size of approximately 52 kDa.

• Immunohistochemical validation: Use both positive controls (tissues known to express MYBPH, such as muscle tissue) and negative controls (antibody diluent only).

• RNAi validation: Compare staining patterns in cells with MYBPH knockdown versus control. Published studies have successfully used shRNA constructs targeting MYBPH (e.g., sequence CTACACCTGCAAGGCCATAAA) .

• Cross-reactivity testing: Verify specificity across relevant species if working with non-human models.

• Immunofluorescence correlation: For ICC/IF applications, correlate subcellular localization with known distribution patterns of MYBPH.

How do MYBPH expression levels correlate with clinical outcomes in glioma research?

Recent research has revealed significant correlations between MYBPH expression and clinical outcomes in glioma:

• Expression pattern: MYBPH is upregulated in glioblastoma (GBM) tissues compared to peritumoral and normal brain tissues

• Correlation with tumor grade: MYBPH expression positively correlates with glioma grade (p=0.002), with highest expression in high-grade gliomas (HGG), particularly GBM

• Association with survival: Multiple datasets (GEPIA and CGGA) demonstrate that higher MYBPH expression correlates with poor prognosis in primary glioma (p<0.0001)

• Molecular subtype associations: MYBPH expression shows significant differences between IDH-wildtype and IDH-mutant groups, with highest expression in IDH-wildtype GBM

• Performance status correlation: MYBPH expression correlates with lower Karnofsky Performance Scale scores (p=0.022), suggesting a relationship with functional impairment

These findings establish MYBPH as a potential prognostic biomarker that could inform clinical decision-making and serve as a therapeutic target in glioma.

What experimental approaches can determine if MYBPH plays a causative role in tumor progression?

To establish causality in MYBPH's role in tumor progression, researchers should implement the following experimental approaches:

• Gene silencing studies: Knockdown MYBPH using validated shRNA constructs to assess effects on cell migration and tumor growth. Multiple shRNAs should be tested to identify constructs with optimal silencing efficiency (e.g., shMYBPH#3 sequence CTACACCTGCAAGGCCATAAA has been validated)

• Rescue experiments: After knockdown, reintroduce MYBPH expression to verify phenotype reversal, confirming specificity of observed effects

• In vivo xenograft models: Compare tumor growth rates between control and MYBPH-knockdown cells in animal models. Previous research showed reduced tumor growth rate and volume in shMYBPH groups compared to control groups (p<0.001)

• Mechanistic studies: Investigate downstream effectors such as ROCK1, which MYBPH is known to inhibit, to elucidate molecular mechanisms

• Cell migration assays: Employ wound healing and transwell assays to quantify the effect of MYBPH modulation on cell motility

• Complementary approaches: Assess effects on cell viability (e.g., using CCK-8 assay), apoptosis, and cell cycle to distinguish migration effects from other cellular processes

How can researchers distinguish between direct and indirect effects when using MYBPH antibodies in co-immunoprecipitation experiments?

When performing co-immunoprecipitation (co-IP) with MYBPH antibodies to identify interaction partners, researchers should implement these controls and approaches:

• Reciprocal co-IP validation: Confirm interactions by performing reverse co-IP using antibodies against suspected binding partners

• Pre-clearing lysates: Remove proteins that non-specifically bind to beads by pre-clearing cell lysates with beads alone before adding MYBPH antibody

• IgG controls: Include isotype-matched IgG controls to identify non-specific binding

• Validation through multiple techniques: Confirm interactions using complementary methods such as proximity ligation assay (PLA) or FRET

• Domain mapping: Identify specific interaction domains using truncation or deletion mutants of MYBPH

• Competition assays: Use recombinant MYBPH protein to compete for antibody binding, which should reduce specific interactions but not non-specific ones

• Stringency optimization: Test different buffer conditions (varying salt concentrations and detergents) to optimize specificity without losing genuine interactions

• Cross-linking experiments: Consider mild cross-linking before lysis to stabilize transient interactions when appropriate

What are the optimal conditions for using MYBPH antibodies in immunohistochemistry?

For optimal immunohistochemical detection of MYBPH in tissue samples:

• Fixation and processing: Use 10% neutral-buffered formalin fixation followed by paraffin embedding. Over-fixation can mask epitopes, so standardize fixation times.

• Antigen retrieval: Heat-induced epitope retrieval (HIER) in citrate buffer (pH 6.0) is generally effective for MYBPH detection.

• Blocking: Thorough blocking with 5-10% normal serum (matched to secondary antibody host) with 0.1-0.3% Triton X-100 for 1-2 hours minimizes background.

• Primary antibody dilution: Optimize antibody concentration experimentally; reported working dilutions include 1:150 for paraffin-embedded human tissues .

• Incubation conditions: Overnight incubation at 4°C typically yields best results.

• Detection system: For chromogenic detection, use appropriate HRP-conjugated secondary antibodies and DAB substrate. For fluorescence, select secondary antibodies with minimal spectral overlap if conducting multiplex staining.

• Counterstaining: Hematoxylin provides good nuclear contrast for brightfield microscopy.

• Controls: Include both positive controls (tissues known to express MYBPH) and negative controls (primary antibody omitted).

How should researchers optimize western blot protocols for detecting MYBPH in different sample types?

For optimal western blot detection of MYBPH:

• Sample preparation: For tissue samples, use RIPA buffer supplemented with protease inhibitors. For cultured cells (e.g., U251, U87), lysis in DMEM with 10% FBS has been effective .

• Protein loading: Load 20-40 μg of total protein per lane; verify equal loading with housekeeping controls.

• Gel percentage: Use 10% SDS-PAGE gels to optimally resolve MYBPH's 52 kDa band .

• Transfer conditions: Transfer to PVDF membranes (preferred over nitrocellulose for MYBPH) at 100V for 90 minutes in Tris-glycine buffer with 20% methanol.

• Blocking: Block membranes with 5% non-fat dry milk in TBST for 1 hour at room temperature.

• Antibody dilution: For mouse monoclonal anti-MYBPH [OTI3G1], a 1:4000 dilution has been validated . Optimize concentration for each specific antibody and application.

• Washing: Implement rigorous washing (5 × 5 minutes) with TBST between antibody incubations.

• Detection: Use enhanced chemiluminescence (ECL) with exposure times optimized for MYBPH signal intensity.

• Troubleshooting: For weak signals, consider longer primary antibody incubation (overnight at 4°C) or signal amplification systems.

What considerations are important when using MYBPH antibodies in multiplex immunofluorescence staining?

For successful multiplex immunofluorescence with MYBPH antibodies:

• Antibody selection: Choose MYBPH antibodies raised in different host species than other target antibodies to avoid cross-reactivity.

• Fluorophore selection: Select fluorophores with minimal spectral overlap. Janelia Fluor 549-conjugated anti-MYBPH is compatible with common fluorophores like FITC/Alexa 488 and far-red dyes.

• Sequential staining: Consider sequential rather than simultaneous staining if cross-reactivity is observed.

• Antibody validation: Validate each antibody individually before combining in multiplex panels.

• Signal separation: Implement appropriate image acquisition settings and spectral unmixing algorithms during analysis.

• Controls: Include single-stained samples for each antibody to confirm specificity and establish compensation settings.

• Order optimization: The order of antibody application can affect staining quality; typically apply MYBPH antibody early in the sequence.

• Fixation effects: Optimize fixation to preserve epitopes for all targets; mild PFA fixation (2-4%) often works well for multiplex approaches.

• Autofluorescence mitigation: Include steps to reduce tissue autofluorescence, particularly important when studying MYBPH in highly autofluorescent tissues like muscle.

How can MYBPH antibodies be utilized to investigate tumor migration and metastasis mechanisms?

MYBPH antibodies can be powerful tools for investigating tumor migration and metastasis through the following approaches:

• Migration pathway analysis: Use MYBPH antibodies in immunofluorescence to visualize relationships between MYBPH expression and cytoskeletal arrangements in migrating tumor cells. This helps elucidate how MYBPH influences cell morphology during migration.

• Quantitative expression studies: Employ MYBPH antibodies in western blots and IHC to quantify expression levels across tumor types and correlate with invasive capacity. Higher MYBPH expression has been linked to increased tumor aggressiveness in glioma .

• Molecular interaction studies: Use co-immunoprecipitation with MYBPH antibodies to identify interaction partners in the migration machinery, particularly focusing on ROCK1 which MYBPH is known to inhibit .

• Metastatic model analysis: Apply MYBPH immunostaining to primary tumors and metastatic lesions to assess changes in expression during metastatic progression.

• Signaling pathway interrogation: Combine MYBPH antibodies with phospho-specific antibodies to investigate how MYBPH affects migration-related signaling cascades.

• Therapeutic response monitoring: Use MYBPH antibodies to assess changes in expression following treatment with migration-targeting therapeutics.

• Live-cell imaging: Apply cell-permeable fluorescently-labeled MYBPH antibodies or antibody fragments to track dynamic changes in MYBPH localization during cell migration in real-time.

What role does MYBPH play in IDH-wildtype versus IDH-mutant gliomas, and how can antibodies help investigate these differences?

Research has revealed important differences in MYBPH expression and function between IDH-wildtype and IDH-mutant gliomas:

• Expression patterns: MYBPH expression is significantly higher in IDH-wildtype gliomas compared to IDH-mutant tumors . This pattern is observed across multiple datasets from the Chinese Glioma Genome Atlas (CGGA).

• Grade-related expression: Within IDH-wildtype and 1p/19q non-codel groups, MYBPH expression increases from lower-grade gliomas (WHO II) to higher-grade gliomas (WHO IV) .

• Prognostic significance: The most favorable outcomes are observed in IDH-mutant and 1p/19q codel groups with the lowest MYBPH expression, while the poorest outcomes occur in IDH-wildtype glioblastomas with high MYBPH expression .

Researchers can investigate these differences using MYBPH antibodies through:

• Comparative IHC studies: Stratify glioma samples by IDH mutation status and compare MYBPH immunostaining patterns and intensities

• Protein-protein interaction analysis: Use co-IP with MYBPH antibodies to identify differential interaction partners in IDH-mutant versus wildtype contexts

• Functional studies: Combine MYBPH antibodies with functional assays to determine how MYBPH contributes to the different biological behaviors of these molecular subtypes

• Therapeutic targeting evaluation: Use MYBPH antibodies to monitor responses to targeted therapies in different molecular subtypes

How can MYBPH antibodies contribute to developing new therapeutic strategies for glioma treatment?

MYBPH antibodies can facilitate the development of novel therapeutic approaches for glioma through several research applications:

• Target validation: MYBPH has been identified as a potential therapeutic target due to its role in promoting tumor progression. Antibodies can validate this target by demonstrating its presence and function in patient-derived samples .

• Patient stratification biomarker: MYBPH expression correlates with prognosis and could identify patients likely to benefit from MYBPH-targeted therapies. Validated IHC protocols using optimized antibody concentrations (e.g., 1:150 dilution for paraffin sections) can reliably assess MYBPH status .

• Therapeutic antibody development: Understanding MYBPH epitopes through research antibodies could inform development of therapeutic antibodies that neutralize MYBPH function.

• Drug screening assays: High-throughput screening for MYBPH inhibitors can be constructed using MYBPH antibodies as detection reagents.

• Mechanism-based combination strategies: Since MYBPH affects ROCK1 signaling, antibody-based studies can identify synergistic combinations targeting this pathway .

• Antibody-drug conjugates (ADCs): For cell-surface accessible MYBPH, ADCs could be developed for targeted therapy delivery.

• Response monitoring: MYBPH antibodies can monitor treatment efficacy by assessing changes in expression or localization following therapeutic intervention.