NCL2 Antibody

What is NCL2 and its role in viral infection research?

Nucleolin (NCL) is the major nucleolar phosphoprotein of growing eukaryotic cells, primarily located in dense fibrillar regions of the nucleolus . In viral infection research, particularly with Enterovirus 71 (EV71), NCL2 cells are specialized cell lines that stably express human nucleolin (hNCL) on their surface. These cells are invaluable experimental models that have demonstrated significantly enhanced virus binding compared to control cells.

Methodologically, researchers can utilize NCL2 cells to study virus-host interactions by:

• Conducting binding assays to quantify the relative virus attachment (2.6-fold increase compared to control NIH 3T3 cells)

• Monitoring virus-induced cytopathic effect (CPE) through temporal analysis at specific timepoints (0, 3, and 9 hours post-infection)

• Examining viral growth kinetics over extended periods (0-48 hours post-infection)

• Comparing virus production levels between NCL2 cells and controls (100-fold higher virus titer at 48 hours post-infection)

These approaches have established that NCL serves as a binding receptor for EV71, meeting all criteria that define a novel binding receptor for this virus .

How do you establish stable NCL-expressing cell lines for viral research?

The establishment of stable NCL-expressing cell lines requires precise molecular cloning and selection techniques:

Methodological approach:

• Gene amplification: The full-length human nucleolin gene (hncl) should be amplified from the cDNA library of target cells (such as RD cells) using specific primer pairs (e.g., 5′-CATGAATTCATGGTGAAGCTCGCG-3′ and 5′-GACTCTAGAACAACCCCACGAACG-3′)

• Cloning into expression vector: Clone the amplified gene into an appropriate expression vector (e.g., p3×FLAG-Myc-CMV-26 carrying three copies of a FLAG tag)

• Transfection: Transfect the constructed plasmid into target cells (such as NIH 3T3 or L929) using an appropriate transfection reagent (e.g., TurboFect)

• Selection of stable clones: Subject transfected cells to selection in medium containing an appropriate antibiotic (e.g., Geneticin)

• Validation: Confirm surface expression of NCL using flow cytometry and total NCL expression using Western blotting

This methodology has successfully established NCL2 cell clones that express significantly higher levels of hNCL on the cell surface compared to control cells, making them valuable models for studying virus-host interactions .

What are the optimal conditions for detecting NCL using immunofluorescence?

When performing immunofluorescence to detect nucleolin, several methodological considerations are crucial for optimal results:

Technical parameters:

• Fixation methods: Both paraformaldehyde-fixed frozen tissue/cell preparations and formalin-fixed, paraffin-embedded tissue sections are compatible with NCL antibodies

• Antibody selection: Mouse monoclonal antibodies such as clone NCL/902 are well-characterized for NCL detection

• Dilution optimization: Typical working concentrations range from 0.25-2 μg/mL for immunofluorescence

• Expected pattern: A characteristic speckled pattern in the nuclei of both normal and malignant cells is indicative of successful NCL detection

• Fluorophore selection: When using conjugated antibodies, avoid blue fluorescent dyes (e.g., CF®405S) for low-abundance targets due to higher non-specific background

Researchers should note that NCL exhibits different localization patterns depending on the cell type and physiological state, with distribution in the nucleus (primarily nucleoli), cytoplasm, and cell membrane . Visualization of membrane-associated NCL may require specialized sample preparation techniques to preserve cell surface proteins.

How can NCL knockdown be effectively achieved for functional studies?

For researchers investigating NCL function through knockdown approaches, the following methodological strategy is recommended:

Experimental design:

• shRNA design: Utilize short hairpin RNA sequences targeting specific regions of NCL (validated sequences include: sh-NCL-1, CCGGAGTAAAGGGATTGCTTATATTCTCGAGAATATAAGCAATCCCTTTACTTTTTTG; and sh-NCL-2, CCGGGCGATCTATTTCCCTGTACTACTCGAGTAGTACAGGGAAATAGATCGCTTTTTG)

• Delivery method: Transfect the shRNA-containing plasmid into target cells using an appropriate transfection reagent (e.g., TurboFect)

• Validation timeline:

  • Assess total NCL expression by Western blotting at 24 hours post-transfection

  • Evaluate cell surface NCL expression by flow cytometry at 24 hours post-transfection

  • Conduct functional assays (virus binding and infection) at 48 hours post-transfection

• Controls: Include appropriate controls such as empty vector-transfected cells and, if relevant, knockdown of other receptors (e.g., SCARB2) for comparison

Research has demonstrated that NCL knockdown significantly reduces EV71 binding to host cells by 50-70%, decreases viral RNA levels by 25-45% at different time points post-infection, and reduces virus production as measured by CCID₅₀ values .

What are the mechanisms of interaction between NCL and viral pathogens?

The interaction between NCL and viral pathogens involves complex molecular mechanisms that researchers can investigate through various experimental approaches:

Methodological investigation:

• Co-immunoprecipitation: To detect protein-protein interactions between NCL and viral components or cellular co-receptors:

  • Perform immunoprecipitation using anti-NCL or anti-receptor (e.g., anti-SCARB2) antibodies

  • Analyze precipitates by Western blotting to detect associated proteins

  • Compare interaction patterns between uninfected and infected cells

• Confocal microscopy: For visualization of co-localization:

  • Perform immunostaining of fixed cells using specific antibodies against NCL, viral proteins, and potential co-receptors

  • Analyze co-localization patterns using confocal microscopy

• Electron microscopy: For high-resolution visualization:

  • Label components with gold-conjugated antibodies of different sizes (e.g., 3-nm for one protein, 13-nm for another)

  • Identify proximity relationships between NCL, viral particles, and co-receptors

Research has revealed that NCL and SCARB2 (another EV71 receptor) associate in uninfected cells, and EV71 infection enhances this association. Electron microscopy has demonstrated that both NCL and SCARB2 are found in close proximity to EV71 particles, suggesting a complex involving multiple proteins during viral entry .

How can researchers quantify cell surface NCL expression in different experimental conditions?

Accurate quantification of cell surface NCL expression is critical for understanding its role in various biological processes:

Quantification methodology:

• Flow cytometry:

  • Harvest cells without enzymatic treatment to preserve surface proteins

  • Incubate with anti-NCL primary antibody (e.g., anti-FLAG for tagged constructs)

  • Apply fluorophore-conjugated secondary antibody or directly use fluorophore-conjugated primary antibody

  • Analyze using flow cytometry with appropriate controls (isotype, unstained)

• Fluorescence intensity analysis:

  • Capture images of immunofluorescence-stained cells

  • Use image analysis software to quantify fluorescence intensity at the cell membrane

  • Compare mean fluorescence intensity values between experimental groups

• Surface protein biotinylation:

  • Selectively label surface proteins with biotin

  • Isolate biotinylated proteins using streptavidin pulldown

  • Detect NCL by Western blotting

  • Quantify band intensity relative to total cellular NCL

These approaches have been used to demonstrate differences in cell surface NCL expression between different cell types and under various experimental conditions, such as after shRNA knockdown or in stable overexpression systems .

What are the critical considerations when using NCL antibodies for co-immunoprecipitation studies?

Co-immunoprecipitation (co-IP) using NCL antibodies requires careful experimental design:

Methodological considerations:

• Antibody selection:

  • Choose antibodies with established efficacy in immunoprecipitation

  • Consider the epitope location - antibodies targeting different domains may yield different results

  • For tagged NCL constructs, anti-tag antibodies (e.g., anti-FLAG) may provide cleaner results

• Lysis conditions:

  • The buffer composition is critical for preserving protein-protein interactions

  • Mild detergents (e.g., NP-40, Triton X-100) at low concentrations maintain interactions

  • Include appropriate protease and phosphatase inhibitors to prevent degradation

• Controls and validation:

  • Include isotype control antibodies

  • Perform reciprocal co-IPs (pull down with anti-NCL and probe for partner, then pull down with anti-partner and probe for NCL)

  • Validate interactions using alternative methods (e.g., proximity ligation assay)

Research employing these approaches has successfully demonstrated the association between NCL and SCARB2 in uninfected cells, as well as increased association and the presence of viral antigens in the complex after EV71 infection .

How can glycoproteomic approaches identify NCL as a virus-interacting protein?

Glycoproteomics offers powerful tools for identifying virus-host protein interactions:

Experimental workflow:

• Glycoprotein enrichment:

  • Prepare cell lysates under conditions that preserve glycoprotein structure

  • Enrich glycoproteins using lectin affinity chromatography or hydrazide chemistry

  • Elute bound glycoproteins under appropriate conditions

• Virus-binding protein identification:

  • Incubate enriched glycoproteins with purified viral particles

  • Isolate virus-binding proteins using ultracentrifugation or affinity methods

  • Analyze bound proteins by mass spectrometry for identification

• Validation of candidates:

  • Confirm interactions using complementary approaches (co-IP, surface plasmon resonance)

  • Assess the effect of candidate protein depletion on virus binding

  • Evaluate the impact of antibodies against candidate proteins on viral infection

This approach successfully identified NCL among 16 EV71-interacting proteins, demonstrating how glycoproteomics can uncover novel virus receptors. The identification was further validated by showing that antibody treatment against the identified glycoproteins reduced EV71 binding to host cells .

What are the most effective methods to visualize NCL-virus interactions using electron microscopy?

Electron microscopy provides high-resolution visualization of NCL-virus interactions:

Technical protocol:

• Sample preparation:

  • Infect cells with the virus of interest at an appropriate MOI

  • Fix cells at specific time points post-infection

  • Process for electron microscopy using protocols that preserve antigenicity

• Immunogold labeling:

  • Use antibodies against different targets conjugated to gold particles of distinct sizes:

    • Small gold particles (e.g., 3-nm) for one protein (e.g., SCARB2)

    • Larger gold particles (e.g., 13-nm) for another protein (e.g., NCL)

  • Apply primary antibodies followed by gold-conjugated secondary antibodies

• Imaging and analysis:

  • Examine prepared samples using transmission electron microscopy

  • Identify viral particles (which may appear as circles in the micrographs)

  • Analyze the spatial relationship between gold-labeled proteins and viral particles

  • Quantify co-localization patterns

This approach has revealed that both NCL (labeled with 13-nm gold particles) and SCARB2 (labeled with 3-nm gold particles) are found in close proximity to EV71 particles, supporting their roles in virus binding and entry .

How does surface NCL function as a target for intracellular drug delivery in cancer research?

Surface NCL represents a promising target for therapeutic delivery systems:

Methodological application:

• Targeting strategies:

  • Utilize NCL-binding molecules such as:

    • AS1411 aptamers (currently in phase II clinical trials)

    • F3 peptide

    • N6L

    • HB-19

    • Anti-NCL antibodies

• Therapeutic mechanisms:

  • Direct targeting of nuclear NCL can induce cancer cell death and decrease malignant transformation in prostate cancer

  • Targeting cytoplasmic NCL has shown efficacy in inducing death of leukemia cells and breast cancer

  • Surface NCL targeting has demonstrated induction of cancer cell death in gastric cancer, rhabdomyosarcoma, breast cancer, and hepatocellular carcinoma

• Delivery system design:

  • Conjugate NCL-targeting molecules to therapeutic payloads

  • Optimize delivery vehicle properties (size, charge, stability)

  • Validate specific binding to cancer cells over normal cells

Research has shown that cell-surface NCL is overexpressed in various cancer cell lines but not their normal counterparts, making it an effective strategic target for cancer treatment . NCL targeting can trigger multiple inhibitory effects depending on the cell type, highlighting its potential in personalized therapeutic approaches .

How can researchers determine the specificity of NCL antibodies across different subcellular compartments?

Validating NCL antibody specificity across subcellular compartments requires rigorous experimental design:

Validation methodology:

• Subcellular fractionation:

  • Separate nuclei, cytoplasm, and membrane fractions using differential centrifugation

  • Extract proteins from each fraction

  • Analyze by Western blotting using the NCL antibody

  • Include compartment-specific markers as controls (e.g., lamin for nucleus, Na⁺/K⁺ ATPase for plasma membrane)

• Immunofluorescence with co-localization:

  • Perform immunofluorescence using the NCL antibody

  • Co-stain with markers for different subcellular compartments:

    • Nucleolar markers (e.g., fibrillarin)

    • Nuclear membrane markers (e.g., lamin)

    • Plasma membrane markers (e.g., Na⁺/K⁺ ATPase)

  • Analyze co-localization patterns using confocal microscopy

• Antibody specificity controls:

  • Include knockdown/knockout cells as negative controls

  • Use blocking peptides to confirm epitope specificity

  • Test multiple antibodies targeting different NCL epitopes

The NCL/902 monoclonal antibody has been validated to stain nucleoli in cell or tissue preparations and can be used as a marker of nucleoli in subcellular fractions . It produces a characteristic speckled pattern in the nuclei of both normal and malignant cells .

What experimental approaches can measure the dynamics of NCL trafficking between subcellular compartments?

Understanding NCL trafficking dynamics requires specialized techniques:

Experimental approaches:

• Live-cell imaging with fluorescent protein fusions:

  • Generate NCL-GFP (or other fluorescent protein) fusion constructs

  • Transfect cells and observe protein localization in real-time

  • Track movement between compartments using time-lapse microscopy

  • Quantify kinetics of translocation between nucleus, cytoplasm, and membrane

• Photoactivatable or photoconvertible fusion proteins:

  • Create NCL fused to photoactivatable GFP or photoconvertible proteins (e.g., Dendra2)

  • Activate/convert the fluorophore in specific subcellular locations

  • Track the movement of the activated/converted population over time

  • Calculate rates of protein movement between compartments

• FRAP (Fluorescence Recovery After Photobleaching):

  • Express fluorescently tagged NCL in cells

  • Photobleach specific subcellular regions containing NCL

  • Monitor fluorescence recovery in the bleached area

  • Analyze recovery curves to determine mobility and exchange rates

Understanding NCL trafficking is particularly important since the mechanism of NCL translocation to the plasma membrane remains unclear, despite evidence that surface NCL serves as an anchor protein binding various molecules implicated in cell differentiation, adhesion, trafficking, inflammation, angiogenesis, and cancer development .

How can researchers differentiate between the functions of membrane, cytoplasmic, and nuclear NCL?

Dissecting compartment-specific NCL functions requires targeted experimental strategies:

Methodological approaches:

• Domain-specific mutants:

  • Generate NCL constructs with mutations in specific targeting sequences:

    • Nuclear localization signal (NLS) mutations for cytoplasmic/membrane retention

    • Nucleolar localization signal mutations for nuclear but non-nucleolar localization

    • Membrane targeting sequence modifications for altered surface expression

  • Express mutants in cells and assess functional consequences

• Compartment-targeted inhibition:

  • Design compartment-specific inhibitors:

    • Antibodies against surface NCL (non-cell-permeable)

    • Aptamers with differential cell permeability

    • Small molecules targeting specific NCL functions

  • Apply inhibitors and measure effects on various cellular processes

• Functional readouts:

  • For nuclear NCL: Assess pre-rRNA transcription, ribosome assembly, chromatin decondensation

  • For cytoplasmic NCL: Evaluate mRNA stability, translation regulation

  • For membrane NCL: Measure ligand binding, signal transduction, internalization of bound molecules

Research has demonstrated distinct functions: nuclear NCL primarily influences pre-rRNA transcription and ribosome assembly ; cytoplasmic NCL affects mRNA stability and translation; and surface NCL serves as a receptor for oncogenic ligands and is implicated in epithelial-mesenchymal transition, protein stabilization, angiogenesis, and lymphangiogenesis .

What are the critical parameters for using NCL antibodies in chromatin immunoprecipitation (ChIP) assays?

When employing NCL antibodies in ChIP assays to study NCL-DNA interactions:

Methodological considerations:

• Crosslinking optimization:

  • Test different formaldehyde concentrations (typically 0.75-1%)

  • Optimize crosslinking time (usually 10-15 minutes)

  • Consider dual crosslinking (formaldehyde plus DSG/EGS) for improved protein-protein fixation

• Chromatin fragmentation:

  • Optimize sonication conditions to generate 200-500 bp fragments

  • Verify fragmentation efficiency by agarose gel electrophoresis

  • Consider micrococcal nuclease digestion as an alternative approach

• Antibody selection and validation:

  • Choose antibodies validated for ChIP applications

  • Test antibody specificity using Western blotting

  • Include appropriate negative controls (IgG, non-specific antibody)

  • Consider using epitope-tagged NCL constructs and ChIP with anti-tag antibodies

• Data analysis:

  • Design primers for regions of interest (e.g., rDNA promoters)

  • Perform qPCR to quantify enrichment

  • Consider ChIP-seq for genome-wide binding profile

Since NCL induces chromatin decondensation by binding to histone H1 and is thought to play a role in pre-rRNA transcription , ChIP assays can provide valuable insights into its chromatin-associated functions.

How do post-translational modifications affect NCL function and antibody recognition?

Post-translational modifications (PTMs) significantly impact NCL function and detection:

Analytical approaches:

• PTM characterization:

  • Employ mass spectrometry-based approaches to identify PTMs:

    • Phosphorylation (particularly in the N-terminal domain)

    • Glycosylation

    • Methylation

    • Acetylation

  • Map modifications to specific domains and residues

• Functional analysis of PTMs:

  • Generate site-specific mutants (phosphomimetic or non-phosphorylatable)

  • Assess impact on localization, binding properties, and function

  • Use PTM-specific inhibitors to modulate modification status

• Antibody selection considerations:

  • Be aware that some antibodies may be sensitive to PTM status

  • Select antibodies with epitopes in regions unlikely to be modified

  • Consider using multiple antibodies targeting different epitopes

  • For phosphorylation-sensitive applications, use phospho-specific antibodies

NCL has a predicted molecular weight of ~76 kDa but typically appears as 100-110 kDa in SDS-PAGE due to phosphorylation of its N-terminal domain . This discrepancy highlights the importance of considering PTMs when interpreting experimental results.

What controls are essential when using NCL antibodies in experimental oncology?

Rigorous controls are crucial when using NCL antibodies in cancer research:

Essential controls:

• Cell line panels:

  • Include multiple cancer cell lines with varying NCL expression levels

  • Incorporate matched normal cell counterparts for comparison

  • Use cell lines with genetic manipulation of NCL (knockdown, knockout, overexpression)

• Antibody validation:

  • Confirm specificity using Western blotting against recombinant NCL

  • Validate using genetic approaches (siRNA/shRNA knockdown)

  • Test multiple antibodies targeting different epitopes

  • Include isotype controls in flow cytometry and immunostaining

• Expression analysis controls:

  • Assess NCL at both mRNA and protein levels

  • Analyze subcellular distribution (nuclear, cytoplasmic, membrane)

  • Quantify surface expression specifically using non-permeabilized cells

• Functional controls:

  • Include specific inhibitors of NCL (e.g., AS1411 aptamer)

  • Use competing ligands for binding studies

  • Employ domain-specific blocking antibodies

Research has shown that NCL overexpression in various cancers correlates with poor prognosis, making proper controls essential for translational studies. Meta-analysis of total and cytoplasmic NCL overexpression indicates a poor prognosis in breast cancer patients .

What methodological approaches can determine the binding affinity between NCL and potential ligands?

Quantifying NCL-ligand interactions requires specific biophysical techniques:

Binding affinity determination methods:

• Surface Plasmon Resonance (SPR):

  • Immobilize purified NCL or the ligand on a sensor chip

  • Flow the binding partner at various concentrations

  • Measure association and dissociation rates in real-time

  • Calculate binding constants (KD, kon, koff)

• Microscale Thermophoresis (MST):

  • Label NCL with a fluorescent dye

  • Mix with varying concentrations of unlabeled ligand

  • Measure changes in thermophoretic mobility

  • Determine KD from the binding curve

• Bio-Layer Interferometry (BLI):

  • Immobilize NCL on biosensors

  • Expose to varying concentrations of ligand

  • Measure wavelength shifts during binding and dissociation

  • Calculate binding parameters

• Isothermal Titration Calorimetry (ITC):

  • Measure heat changes during binding

  • Determine thermodynamic parameters (ΔH, ΔG, ΔS)

  • Calculate stoichiometry and binding affinity