ndufaf5 Antibody

What is NDUFAF5 and what is its primary function?

NDUFAF5 (NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 5) functions as an arginine hydroxylase involved in the assembly of mitochondrial NADH:ubiquinone oxidoreductase complex (complex I) at early stages of biogenesis . It specifically mediates the hydroxylation of arginine-111 of NDUFS7, which is a critical subunit of complex I . NDUFAF5 was initially predicted to contain a methyltransferase domain and may also possess methyltransferase activity, though its primary confirmed function is arginine hydroxylation .

Research in Dictyostelium models demonstrates that disruption of Ndufaf5 leads to complex I deficiency and subsequent defects in growth and development . Mutations in this protein are associated with mitochondrial complex I disease in humans, including Leigh syndrome .

What are the recommended applications for NDUFAF5 antibodies?

Based on validation studies, NDUFAF5 antibodies have been successfully employed in multiple experimental applications:

• Western Blot (WB): Effective at dilutions ranging from 1:500-1:5000 depending on the specific antibody

• Immunoprecipitation (IP): Successfully used at approximately 1:100 dilution

• Immunocytochemistry/Immunofluorescence (ICC/IF): Useful for cellular localization studies at dilutions around 1:400

• Flow Cytometry (Intracellular): Effective at approximately 1:200 dilution

• Immunohistochemistry-Paraffin embedded (IHC-P): Successful with antigen retrieval using Tris/EDTA buffer pH 9.0

When designing experiments, it is recommended to optimize the antibody concentration for your specific sample type and experimental conditions .

What is the subcellular localization of NDUFAF5?

NDUFAF5 is primarily localized to mitochondria as confirmed by fluorescence microscopy studies using GFP-tagged NDUFAF5 constructs . Immunofluorescent analysis shows a characteristic mitochondrial staining pattern when using appropriate NDUFAF5 antibodies . This mitochondrial localization is consistent with its functional role in complex I assembly, which occurs within the mitochondria .

How should I design experiments to study the effect of NDUFAF5 knockdown on complex I assembly?

When designing experiments to investigate NDUFAF5 knockdown effects:

• siRNA approach: Target NDUFAF5 with specific siRNAs at approximately 50 nM concentration. Include negative control siRNAs to account for non-specific effects .

• Verification of knockdown:

  • Confirm reduction of NDUFAF5 transcript levels by RT-PCR or qPCR (60-70% reduction is typically sufficient to observe phenotypes)

  • Verify protein reduction by western blot using validated NDUFAF5 antibodies

• Functional assays:

  • Measure complex I activity using enzymatic assays

  • Assess the hydroxylation status of Arg-73 in NDUFS7, which is directly modified by NDUFAF5

  • Monitor complex I assembly using blue native PAGE followed by western blotting with antibodies against complex I subunits (NDUFS2, NDUFS7, ND1)

• Cellular consequences:

  • Measure oxygen consumption rate (OCR) to assess effects on cellular energetics

  • Calculate the E/L ratio (early/late) of complex I assembly intermediates

  • Investigate potential compensatory mechanisms such as changes in citrate synthase activity

Research indicates that NDUFAF5 depletion affects early stages of complex I assembly and may have secondary effects on complex IV activity in some cell types .

What controls should be included when using NDUFAF5 antibodies for immunofluorescence studies?

For rigorous immunofluorescence experiments with NDUFAF5 antibodies, include these essential controls:

• Negative controls:

  • Primary antibody omission control: Incubate samples with secondary antibody only

  • Isotype control: Use an irrelevant primary antibody of the same isotype and concentration

  • When using anti-NDUFAF5 at 1:400 dilution, include a control with secondary antibody (e.g., Goat anti-mouse IgG Alexa Fluor 594) at 1:400 dilution

• Positive controls:

  • Cell lines known to express NDUFAF5 (e.g., NIH 3T3, HeLa, 293)

  • Co-staining with mitochondrial markers (e.g., TOMM20) to confirm mitochondrial localization

• Specificity verification:

  • NDUFAF5 knockdown cells should show reduced signal

  • NDUFAF5 overexpression should show increased signal

  • Use multiple antibodies targeting different epitopes of NDUFAF5 when possible

• Fixation optimization:

  • 4% paraformaldehyde fixation with 0.1% Triton X-100 permeabilization has been validated for NDUFAF5 detection

Always counterstain nuclei (e.g., with DAPI) for proper cellular orientation and interpretation of subcellular localization .

How can I distinguish between the methyltransferase and hydroxylase activities of NDUFAF5 in experimental settings?

Distinguishing between these enzymatic activities requires strategic experimental design:

• Site-directed mutagenesis approach:

  • Create mutations in the putative SAM-binding domain of NDUFAF5 that would specifically affect methyltransferase activity

  • Mutations in key residues of the predicted hydroxylase domain

  • Express these mutants in NDUFAF5-null backgrounds to assess functional complementation

• Activity assays:

  • For hydroxylase activity: Measure hydroxylation levels of Arg-73/Arg-111 in NDUFS7 using mass spectrometry before and after NDUFAF5 manipulation

  • For methyltransferase activity: Develop methylation-specific assays using potential substrates

• Structural analysis:

  • Use protein structural prediction tools to identify the SAM-binding domain and hydroxylase domain

  • Design experiments based on conserved domains identified through the Conserved Domains Database (CDD)

• Biochemical inhibition:

  • Use specific inhibitors of methyltransferases vs. hydroxylases to differentially affect activity

  • Monitor effects on complex I assembly and NDUFS7 modifications

Research indicates that the hydroxylase activity toward NDUFS7 is well-established, while the methyltransferase activity remains probable but requires further experimental verification .

What is the relationship between NDUFAF5 deficiency, complex I dysfunction, and autophagy activation?

The relationship between NDUFAF5 deficiency, complex I dysfunction, and autophagy appears to be mechanistically linked:

• Observed autophagy activation:

  • Ndufaf5-deficient strains show increased autophagy in Dictyostelium models

  • This was also observed in MidA (another CI assembly factor) null mutants, suggesting a common response to CI dysfunction

• Potential mechanisms linking CI dysfunction to autophagy:

  • Energy depletion sensed through altered ATP levels (though paradoxically, some NDUFAF5-null cells show increased ATP levels)

  • ROS signaling from dysfunctional electron transport chain

  • Mitochondrial quality control mechanisms responding to dysfunctional mitochondria

• AMPK-independent pathways:

  • Inhibition of AMPK expression in Ndufaf5-null mutants does not rescue the phenotypes associated with Ndufaf5 deficiency

  • This suggests novel AMPK-independent pathways connecting mitochondrial CI dysfunction to cellular pathology

  • Autophagy activation may represent a compensatory mechanism rather than a pathological outcome

• Experimental approaches to investigate this relationship:

  • Monitor autophagy markers (LC3, p62) in cells with NDUFAF5 knockdown

  • Use autophagy inhibitors in NDUFAF5-deficient cells to determine if phenotypes are exacerbated

  • Examine mitochondrial morphology and turnover with dual fluorescent reporters

This relationship suggests wider effects of CI dysfunction on cellular homeostasis than previously recognized and may represent a potential therapeutic target .

What are the optimal Western blot conditions for detecting NDUFAF5 in different tissue and cell samples?

Optimal Western blot conditions for NDUFAF5 detection:

For tissue-specific detection, NDUFAF5 has been successfully detected in human skeletal muscle, fetal liver, and multiple mouse tissues (brain, heart, kidney, spleen) . The protocol may require optimization depending on tissue type, with muscle tissues potentially requiring stronger lysis conditions.

How can I validate NDUFAF5 knockdown at both mRNA and protein levels?

A comprehensive validation approach for NDUFAF5 knockdown should include:

• mRNA level validation:

  • RT-PCR: Use primers spanning different exons to verify specific knockdown

    • Forward primers in 5'UTR or exon 1: 5'GCACAAAAAGCGCCGGCAAT3' or 5'AGGGAAGTCACCTCTGGTGT3'

    • Reverse primers in exon 3 or 4: 5'TGTGCAATGTAACCTCTTCCA3' or 5'TTCTGCAATGTCAGCTTGGA3'

  • Quantitative PCR (qPCR): For precise quantification of knockdown efficiency

    • Use multiple primer sets targeting different exons to ensure complete knockdown

    • Example primer sets from exon 1-2, 2-4, 7-8, and 11-12 have been validated

    • Calculate relative expression using appropriate reference genes

• Protein level validation:

  • Western blot: Use validated NDUFAF5 antibodies (1:500-1:2000 dilution)

    • Include appropriate loading controls (β-actin, TOMM20 for mitochondrial normalization)

    • Quantify band intensity using densitometry software

  • Immunofluorescence: Visual confirmation of reduced NDUFAF5 protein

    • Compare signal intensity between control and knockdown cells

    • Co-stain with mitochondrial markers to ensure specificity

• Functional validation:

  • Complex I activity assay: Reduced complex I activity confirms functional consequence

  • NDUFS7 hydroxylation: Reduced hydroxylation of Arg-73 in NDUFS7 confirms functional impact

Research indicates that 60-70% reduction in NDUFAF5 transcript levels is typically sufficient to observe functional consequences on complex I assembly and activity .

How can I distinguish between direct effects of NDUFAF5 deficiency and secondary compensatory mechanisms in experimental data?

Distinguishing primary from secondary effects requires careful experimental design and analysis:

• Time-course experiments:

  • Monitor changes following NDUFAF5 knockdown at multiple time points (e.g., 24h, 48h, 72h, 120h, 192h)

  • Early changes are more likely to represent direct effects, while later changes may include compensatory mechanisms

  • Research shows progressive reduction in E/L ratio and OCR at 120h vs. 192h post-NDUFAF5 suppression

• Pathway-specific analysis:

  • Direct effects: Focus on complex I assembly intermediates, NDUFS7 hydroxylation

  • Secondary effects: Monitor mitochondrial mass (citrate synthase activity), ATP levels, autophagy markers

  • Research shows increased citrate synthase activity and ATP levels in Ndufaf5-null cells, suggesting compensatory mechanisms

• Genetic approach:

  • Use rescue experiments with wild-type NDUFAF5 vs. mutated versions

  • Effects reversed by wild-type but not by function-specific mutants help distinguish direct from indirect effects

  • Site-directed mutagenesis in the methyltransferase domain can help separate different functions

• Combined knockdown experiments:

  • Compare phenotypes between single NDUFAF5 knockdown and double knockdowns

  • Research shows that inhibition of AMPK expression in Ndufaf5-null mutants does not rescue phenotypes, suggesting AMPK-independent pathways

• Multi-omics approach:

  • Integrate transcriptomics, proteomics, and metabolomics data

  • Look for temporal patterns and pathway enrichment

  • Construct network models to identify direct vs. propagated effects

When analyzing complex I deficiency, consider that effects on complex IV observed in some cell types may represent tissue-specific secondary consequences rather than direct NDUFAF5 functions .

How should I interpret conflicting results between protein expression levels and enzyme activity measurements in NDUFAF5 studies?

When facing discrepancies between NDUFAF5 protein levels and functional outcomes:

• Post-translational modifications:

  • NDUFAF5 function may depend on its own post-translational modifications

  • Antibodies may detect total protein but not functionally active forms

  • Consider phosphorylation, acetylation, or other modifications that may affect activity

• Protein-protein interactions:

  • NDUFAF5 functions within a complex network of assembly factors

  • Changes in interacting partners (NDUFAF3, NDUFAF4) may alter function without changing expression

  • Co-immunoprecipitation experiments can reveal changes in protein interactions

• Substrate availability:

  • NDUFAF5 hydroxylase activity requires NDUFS7 substrate

  • Changes in substrate availability may affect activity independent of NDUFAF5 levels

  • Measure both enzyme and substrate levels in parallel

• Threshold effects:

  • Complex I assembly may have threshold requirements for NDUFAF5

  • Partial reductions may have minimal effects until a critical threshold is reached

  • Research shows that 60-70% knockdown of NDUFAF5 is sufficient to observe phenotypes

• Paradoxical findings interpretation:

  • Increased ATP levels observed in some NDUFAF5-deficient cells despite CI deficiency suggests compensatory mechanisms

  • Consider alternative ATP production pathways (glycolysis upregulation)

  • Examine mitochondrial mass markers (citrate synthase) which may increase as compensation

• Technical considerations:

  • Ensure antibodies detect the relevant protein isoforms

  • Consider sample preparation differences between protein and activity assays

  • Normalize appropriately (total protein vs. mitochondrial markers)

When interpreting such discrepancies, construct a working model that incorporates both observations, potentially involving feedback mechanisms, compensatory pathways, or thresholds for biological effects.

What are common issues when using NDUFAF5 antibodies and how can they be resolved?

For optimal results with NDUFAF5 antibodies in IHC-P applications, perform heat-mediated antigen retrieval with Tris/EDTA buffer pH 9.0 before commencing with the staining protocol .

How can I differentiate between NDUFAF5 deficiency phenotypes and other complex I assembly factor deficiencies?

To distinguish NDUFAF5 deficiency from other complex I assembly factor defects:

• Specific molecular signatures:

  • NDUFAF5 deficiency: Reduced hydroxylation of Arg-73/Arg-111 in NDUFS7

  • NDUFAF7 deficiency: Different methylation patterns of complex I subunits

  • MidA deficiency: Similar phenotypes but different molecular signatures

• Assembly intermediate analysis:

  • NDUFAF5 affects early stages of complex I assembly

  • NDUFB3 deficiency affects later stages (distal membrane arm assembly)

  • Blue native PAGE followed by western blotting with stage-specific antibodies can reveal pattern differences

• Rescue experiments:

  • Complementation with specific assembly factors

  • NDUFAF5-null phenotypes are specifically rescued by NDUFAF5 expression

  • Cross-complementation experiments between different assembly factor deficiencies

• Co-immunoprecipitation patterns:

  • Different assembly factors have distinct interaction partners

  • NDUFAF5 interacts strongly with NDUFS7, NDUFAF3, and NDUFAF4

  • Compare interaction profiles to distinguish between deficiencies

• Timing of defects:

  • Monitor assembly intermediates at different time points

  • Early vs. late defects in assembly pathway can distinguish between factors

The analysis of specific post-translational modifications of complex I subunits provides the most definitive differentiation between assembly factor deficiencies .