NECAP2 Antibody

What is the functional significance of NECAP2 in cellular biology?

NECAP2 functions as a pathway-specific modulator of clathrin coat formation on early endosomes. It is crucial for:

• Fast endocytic recycling

• Maintenance of receptor levels on the cell surface

• Re-sensitization of cells to extracellular ligands

• Sustained nutrition uptake

NECAP2 specifically regulates the endocytic recycling of receptors including EGFR and transferrin receptor in the fast recycling pathway that directly returns cargo from early endosomes to the cell surface . Unlike its brain-enriched paralog NECAP1, the ubiquitously-expressed NECAP2 recruits the clathrin adaptor AP-1 to early endosomes to facilitate this recycling process .

What sample types have been validated for NECAP2 antibody applications?

What are the recommended protocols for NECAP2 antibody-based Western blotting?

For optimal Western blot results with NECAP2 antibodies:

• Sample preparation:

  • Lyse tissues/cells in RIPA buffer supplemented with phosphatase and protease inhibitors

  • Denature samples at 100°C for 15 minutes

• Gel electrophoresis:

  • Use 10% SDS-PAGE for optimal separation

  • Expected molecular weight: 28 kDa (calculated), 35-37 kDa (observed)

• Membrane transfer:

  • Transfer to PVDF membranes

  • Block with 5% skim milk powder for 1 hour

• Primary antibody incubation:

  • Recommended dilution: 1:500-1:1000

  • Incubate overnight at 4°C

• Secondary antibody:

  • Use appropriate HRP-conjugated secondary antibody (typically 1:2000)

  • Incubate for 2 hours at room temperature

• Detection:

  • Visualize using ECL chemiluminescence reagent

  • Recommended detection system: Chemidoc or equivalent imaging system

How can NECAP2 antibodies be utilized to investigate its role in glioma progression?

NECAP2 expression correlates with glioma progression and immune infiltration. A multifaceted approach using NECAP2 antibodies includes:

• Expression analysis in patient samples:

  • Immunohistochemistry (IHC) staining using NECAP2 antibodies (1:200 dilution) to assess protein expression across different tumor grades

  • Western blotting to quantify expression levels in tumor versus normal tissue

• Prognostic correlation:

  • Stratify patients based on NECAP2 expression levels

  • Correlate with clinical outcomes using Kaplan-Meier survival analysis

  • Data indicates that glioma patients with NECAP2 overexpression have a remarkably higher risk of developing malignant behavior and worse prognosis

• Functional studies:

  • Use NECAP2 antibodies to validate knockdown efficiency in siRNA experiments (suggested siRNA sequences: CAACATCGCAAACATGAAGAA and GATGCCTTTGACTTCAATGTT)

  • Perform wound-healing and Transwell assays following NECAP2 knockdown to assess effects on cell migration and invasion

• Immune infiltration analysis:

  • Combine NECAP2 antibody staining with immune cell markers to evaluate correlation with infiltrating immune cells

  • NECAP2 expression has been shown to correlate with infiltration of T cells, mast cells, neutrophils, NK cells, DCs, and macrophages in glioma

What methodologies are recommended for studying NECAP2 interactions with adaptor protein complexes?

To investigate NECAP2 interactions with adaptor protein complexes such as AP-1 and AP-2:

• Co-immunoprecipitation (Co-IP):

  • Use NECAP2 antibodies to pull down protein complexes from cellular lysates

  • Blot for adaptor protein subunits (α-, β2-, σ2-adaptin for AP-2; γ-, β1-, σ1-adaptin for AP-1)

  • Previous studies have shown that significant portions of AP-2 (19.6 ± 6.5%) are constitutively bound to NECAP1, suggesting similar approaches may work for NECAP2

• Protein-protein interaction analysis:

  • Utilize the STRING database (https://string-db.org/) with a confidence level of 0.4 to evaluate potential interactions

  • Perform GO and KEGG enrichment analyses to examine biological roles and pathways related to NECAP2-interacting proteins

• Structure-function analysis:

  • Express mutated versions of NECAP2 lacking specific domains

  • Use antibodies to verify expression and perform pulldown assays to determine which domains are critical for AP-1 recruitment to early endosomes

• In vitro pulldown assays:

  • Use purified recombinant NECAP2 as bait

  • Use vertebrate AP2 cores as prey

  • Co-express with the kinase domain from mouse AAK1 to generate phosphorylated AP2

  • Previous studies with NECAPs have shown they bind open and phosphorylated forms of AP2 but not phosphorylation-defective AP2 mutants

What approaches are recommended for investigating NECAP2 in endosomal trafficking using available antibodies?

To study NECAP2's role in endosomal trafficking:

• Subcellular fractionation:

  • Isolate clathrin-coated vesicles (CCVs) from tissues/cells

  • Use NECAP2 antibodies to detect its enrichment in coat fractions stripped from CCVs

  • Previous studies have shown that NECAP isoforms partition with clathrin into coat fractions

• Immunofluorescence co-localization:

  • Co-stain cells with NECAP2 antibodies and markers for:

    • Early endosomes (EEA1)

    • Clathrin (clathrin heavy chain)

    • Adaptor proteins (AP-1, AP-2)

  • Use high-resolution microscopy to visualize NECAP2 localization during endocytic recycling

• Live-cell imaging:

  • Express fluorescently-tagged cargo proteins (EGFR-GFP, Transferrin receptor-GFP)

  • Perform pulse-chase experiments following NECAP2 knockdown

  • Quantify recycling dynamics and receptor surface levels

  • Previous studies demonstrated that NECAP2 functions in the fast recycling pathway directly returning cargo from early endosomes to the cell surface

• Morphological analysis:

  • Use NECAP2 antibodies to verify knockdown efficiency

  • Examine early endosome morphology using confocal microscopy

  • NECAP2 knockdown leads to enlarged early endosomes and causes loss of AP-1 adaptor from the organelle

How can researchers utilize NECAP2 antibodies to investigate its role in cancer immune microenvironment?

NECAP2 has been implicated in immune infiltration in glioma. To investigate this relationship:

• Multiplex immunohistochemistry:

  • Combine NECAP2 antibody staining with markers for various immune cell populations

  • NECAP2 expression correlates with infiltration of:

    • T cells (CD4+ and CD8+)

    • Mast cells

    • Neutrophils

    • NK cells

    • Dendritic cells

    • Macrophages

    • Regulatory T cells (Treg)

• Correlation analysis with immune checkpoints:

  • Perform co-expression analysis of NECAP2 with immune checkpoint molecules

  • Use CIBERSORT algorithm (http://cibersort.stanford.edu/) to deconvolute gene expression data and determine relative correlation between NECAP2 expression and tumor-infiltrating immune cells

• Functional validation in experimental models:

  • Knock down NECAP2 in tumor cells

  • Co-culture with immune cells

  • Measure changes in immune cell recruitment, activation, and function

  • Analyze cytokine production and immune response

What are the recommended approaches for troubleshooting non-specific binding with NECAP2 antibodies?

When encountering non-specific binding with NECAP2 antibodies:

• Antibody validation:

  • Verify antibody specificity using positive controls (recommended samples: MCF7 cells, HeLa cells, mouse cerebellum tissue)

  • Include negative controls (secondary antibody only, isotype control)

  • Consider using NECAP2 knockdown samples as additional negative controls

• Blocking optimization:

  • Test different blocking agents (5% BSA vs. 5% milk)

  • Increase blocking time (1 hour to overnight)

  • Add 0.1-0.3% Triton X-100 to reduce background

• Antibody concentration:

  • Titrate antibody dilutions (recommended range: 1:500-1:2000 for WB)

  • For IHC, optimize from 1:100 to 1:400

• Washing steps:

  • Increase number and duration of washes

  • Use PBS-T (PBS with 0.1% Tween-20) for more stringent washing

• Cross-reactivity considerations:

  • Be aware that anti-NECAP1 antibodies may cross-react with NECAP2 (noted in one study)

  • When possible, use antibodies raised against unique regions of NECAP2

What control samples should be included when working with NECAP2 antibodies?

For rigorous scientific investigation with NECAP2 antibodies:

• Positive controls:

  • MCF7 cells

  • HeLa cells

  • Human liver tissue

  • Mouse cerebellum tissue

• Negative controls:

  • NECAP2 knockdown samples (validated siRNAs: CAACATCGCAAACATGAAGAA and GATGCCTTTGACTTCAATGTT)

  • Secondary antibody only controls

  • Isotype-matched IgG controls

• Gradient expression samples:

  • Glioma tissues of different grades (NECAP2 expression increases with tumor grade)

  • Normal adjacent tissues for comparison

What are the established parameters for quantifying NECAP2 expression in research samples?

For reliable quantification of NECAP2 expression:

• Western blot quantification:

  • Normalize to appropriate housekeeping proteins (GAPDH has been validated)

  • Use densitometry software (ImageJ or equivalent)

  • Present data as fold change relative to control samples

• IHC scoring methods:

  • H-score system (combines intensity and percentage of positive cells)

  • Semi-quantitative scoring (0: negative, 1+: weak, 2+: moderate, 3+: strong)

  • Digital image analysis for more objective quantification

• Statistical analysis:

  • For comparing NECAP2 expression across groups, use Wilcoxon signed-rank test or Kruskal-Wallis test as appropriate

  • For correlation with clinical parameters, employ chi-square or Fisher exact tests

  • For survival analysis, utilize Kaplan-Meier method and Cox regression

How can researchers effectively study NECAP2 phosphorylation and other post-translational modifications?

To investigate NECAP2 post-translational modifications:

• Phosphorylation analysis:

  • Use phosphatase inhibitors during sample preparation

  • Employ Phos-tag gels to separate phosphorylated from non-phosphorylated forms

  • Consider using phospho-specific antibodies if available

• Interaction with kinases:

  • Co-IP experiments to identify interacting kinases

  • In vitro kinase assays with purified components

  • Mass spectrometry to identify phosphorylation sites

• Functional significance:

  • Express phosphomimetic (S/T to D/E) or phospho-deficient (S/T to A) mutants

  • Assess effects on localization, protein interactions, and function

  • The AP2 µ2 subunit's phosphorylation status has been shown to be regulated by NECAPs, suggesting potential regulatory mechanisms through phosphorylation

How should researchers interpret discrepancies between predicted and observed molecular weights for NECAP2?

NECAP2 has a calculated molecular weight of 28 kDa but is often observed at 35-37 kDa in Western blots . To address this discrepancy:

• Potential explanations:

  • Post-translational modifications (phosphorylation, glycosylation)

  • Protein-protein interactions resistant to denaturation

  • Structural features affecting electrophoretic mobility

• Validation approaches:

  • Use multiple antibodies targeting different epitopes

  • Perform mass spectrometry to confirm protein identity

  • Include NECAP2 knockdown or knockout controls

  • Express recombinant NECAP2 as a size reference

• Reporting recommendations:

  • Clearly specify both calculated and observed molecular weights

  • Note any sample-specific variations in migration pattern

  • Document gel percentage and running conditions

What methodological considerations should be taken when studying NECAP2 in different cellular compartments?

NECAP2 functions at the interface of early endosomes and the cell surface. For accurate compartmental analysis:

• Subcellular fractionation:

  • Use differential centrifugation to isolate membrane fractions

  • Purify clathrin-coated vesicles using established protocols

  • Verify fraction purity using compartment-specific markers:

    • Early endosomes: EEA1, Rab5

    • Plasma membrane: Na+/K+ ATPase

    • Clathrin-coated vesicles: Clathrin heavy chain, AP-1/AP-2

• Immunofluorescence approaches:

  • Use confocal microscopy with appropriate resolution

  • Employ super-resolution techniques for detailed localization

  • Co-stain with markers for different compartments

• Biochemical analysis:

  • Perform protease protection assays to determine topology

  • Use surface biotinylation to distinguish plasma membrane vs. internal pools

  • Consider proximity labeling approaches (BioID, APEX) to identify compartment-specific interactors

How can researchers accurately interpret NECAP2's role in immune infiltration of tumors?

Based on the correlation between NECAP2 expression and immune cell infiltration in gliomas:

• Data interpretation guidelines:

  • Distinguish correlation from causation

  • Consider NECAP2's known functions in endocytosis and receptor recycling

  • Analyze multiple immune cell types simultaneously using deconvolution approaches like CIBERSORT

• Validation approaches:

  • Conduct in vitro co-culture experiments with tumor and immune cells

  • Perform mechanistic studies to determine if NECAP2 directly affects immune cell function

  • Use animal models with NECAP2 manipulation to assess changes in immune infiltration

• Clinical correlations:

  • Correlate NECAP2 expression with established immune signatures

  • Assess relationship with response to immunotherapy

  • Consider combination with other prognostic markers for improved prediction accuracy

What are the potential applications of NECAP2 antibodies in studying neurodegenerative diseases?

Given NECAP2's role in endocytosis and receptor recycling:

• Potential research applications:

  • Investigate NECAP2 expression and localization in neurodegenerative disease models

  • Study its interaction with disease-associated proteins that undergo endocytosis

  • Examine potential dysregulation in receptor recycling pathways implicated in neurodegeneration

• Methodological approaches:

  • Immunohistochemistry in brain tissue from disease models and patients

  • Co-IP to identify altered interactions in disease states

  • Functional recycling assays in neuronal models

• Technical considerations:

  • Use neuron-specific markers for co-localization studies

  • Consider brain region-specific expression patterns

  • Employ age-matched controls for developmental comparisons

How can researchers apply new antibody fusion technologies to enhance NECAP2 studies?

Recent advances in antibody engineering offer new opportunities for NECAP2 research:

• Fusion protein approaches:

  • Create NECAP2 antibody-based fusion proteins for targeted manipulation

  • Develop proximity-based labeling tools by fusing enzymes to NECAP2 antibodies

  • These approaches can stabilize protein complexes during immunization, as demonstrated in recent studies

• Implementation strategies:

  • Use recombinant antibody fragments (Fab, scFv) fused to reporter proteins

  • Develop optogenetic tools based on NECAP2 antibody targeting

  • Create bifunctional antibodies recognizing NECAP2 and interacting partners

• Validation requirements:

  • Confirm retained specificity after fusion

  • Verify that fusion proteins don't interfere with native NECAP2 function

  • Establish appropriate controls for each fusion construct