wip1 Antibody

What is Wip1 and why is it important in biological research?

Wip1 (Wild-type p53-induced phosphatase 1) is a protein encoded by the PPM1D gene (protein phosphatase, Mg2+/Mn2+ dependent 1D). It functions primarily in DNA damage response pathways and cell proliferation regulation. The human Wip1 protein has a canonical amino acid length of 605 residues and a molecular mass of 66.7 kilodaltons, with two identified isoforms . Wip1 is localized in both the nucleus and cytoplasm of cells and is notably expressed in various tissues including the caudate, tonsil, and adrenal gland .

The protein is critical in research because it plays a significant role in the timely inactivation of DNA damage response by suppressing p53 function and other targets at chromatin. Recent research has revealed that Wip1 promotes DNA repair through homologous recombination, making it a crucial subject for studies involving genomic stability and cancer biology .

How do researchers distinguish between the different isoforms of Wip1 using antibodies?

Distinguishing between Wip1 isoforms requires careful antibody selection targeting isoform-specific epitopes. When performing immunoblotting experiments, researchers should:

• Utilize antibodies specifically raised against unique regions of each isoform

• Run proper molecular weight controls to identify the 66.7 kDa canonical Wip1 protein versus its isoforms

• Employ immunoprecipitation followed by mass spectrometry to verify isoform identity

• Consider using genetic knockouts of specific isoforms as negative controls

When analyzing western blot results, researchers should observe band patterns carefully, as the two identified isoforms will present distinct molecular weights. Additional validation through siRNA knockdown experiments targeting specific isoform transcripts can provide further confirmation of antibody specificity.

What are the common alternative names for Wip1 protein that researchers should be aware of when searching for antibodies?

Researchers investigating Wip1 should be familiar with all nomenclature variations to ensure comprehensive literature searches and appropriate antibody selection. Common alternative designations for Wip1 include:

• PPM1D (Protein phosphatase, Mg2+/Mn2+ dependent 1D)

• IDDGIP (Islet cell death-associated protein-derived gene induced by TP53)

• JDVS (Juvenile-onset developmental delay, hearing loss, and vertigo syndrome)

• PP2C-DELTA (Protein phosphatase 2C isoform delta)

When searching scientific databases or antibody resources, incorporating these alternative names will ensure comprehensive results. For antibody validation purposes, confirming target specificity against PPM1D/Wip1 through knockout controls is essential regardless of which nomenclature is used by manufacturers.

What are the optimal applications for Wip1 antibodies in experimental research?

Based on current research applications, Wip1 antibodies are most effectively utilized in several key experimental techniques:

• Western Blot: The most common application for Wip1 antibodies, providing quantitative analysis of total protein expression levels in cell and tissue lysates

• Immunohistochemistry (IHC): Permits visualization of Wip1 protein localization in fixed tissues, allowing assessment of expression patterns in different cell types and subcellular compartments

• Enzyme-Linked Immunosorbent Assay (ELISA): Enables quantitative measurement of Wip1 protein levels in solution-based samples

• Immunoprecipitation: Particularly valuable for studying Wip1 protein interactions with partners like BRCA1 and 53BP1

• Immunofluorescence: Allows subcellular localization studies to confirm nuclear and cytoplasmic distribution patterns

For optimal results, researchers should select antibodies specifically validated for their intended application, as performance can vary significantly across different experimental contexts.

How should researchers optimize immunohistochemistry protocols for detecting Wip1 in tissue samples?

Optimizing IHC protocols for Wip1 detection requires careful attention to several methodological factors:

• Tissue Processing and Fixation:

  • Use 4-μm sections from paraffin-embedded blocks

  • Proper dehydration steps are essential

  • Incubate in 3% hydrogen peroxide (12 minutes) to block endogenous peroxidase

  • Perform trypsin treatment (18 minutes) for antigen retrieval

• Antibody Selection and Dilution:

  • Use validated anti-Wip1 monoclonal antibodies (rabbit anti-human Wip1 at 1:100 dilution has been reported effective)

  • Include appropriate negative controls by replacing primary antibody with PBS

• Signal Development and Assessment:

  • Employ 3,3′-diaminobenzidine staining visualized with hematoxylin

  • Have two independent pathologists score slides

  • Classify samples as positive when >10% of cells show yellow/brown staining

• Validation Controls:

  • Include known Wip1-positive tissues (such as specific cancer samples)

  • Consider parallel Western blot analysis of fresh tissues from the same source using RIPA buffer for protein extraction

This methodological approach has been successfully employed in studies examining Wip1 expression in cancer tissues versus normal tissues.

What are the key considerations for proper sample preparation when using Wip1 antibodies in Western blotting?

Effective Western blot analysis for Wip1 requires meticulous sample preparation techniques:

• Protein Extraction:

  • Use RIPA buffer supplemented with protease and phosphatase inhibitors

  • For chromatin-associated Wip1, include benzonase (100 U/mL) in lysis buffer

  • Brief sonication followed by addition of ethidium bromide (50 μg/mL) improves extraction of nuclear proteins

  • Centrifuge lysates (30 min, 4°C, 20,000 g) to remove debris

• Protein Quantification:

  • Employ BCA Protein Assay kit for accurate concentration determination

  • Load standardized amounts (approximately 50 μg) of total protein per lane

• Gel Electrophoresis Parameters:

  • Use 10% SDS-PAGE for optimal resolution of the 66.7 kDa Wip1 protein

  • Include molecular weight markers spanning 50-75 kDa range

• Transfer and Detection Optimization:

  • Transfer to PVDF membranes

  • Block with 5% non-fat milk (1 hour)

  • Incubate with Wip1 primary antibody (1:200 dilution) overnight at 4°C

  • Include GAPDH (1:1,000) as loading control

This protocol ensures reliable detection of Wip1 in various tissue types while minimizing background and non-specific binding.

How does Wip1 function in the DNA damage response pathway, and how can this be studied using antibodies?

Wip1 serves as a critical negative regulator in the DNA damage response (DDR) pathway through several mechanisms:

• p53 Regulation: Wip1 dephosphorylates p53 at Ser15, attenuating its activity and promoting recovery from cell cycle arrest after DNA damage repair is complete .

• 53BP1 Modification: Wip1 interacts with and dephosphorylates 53BP1 at Threonine 543, which affects its interaction with RIF1 and influences DNA repair pathway choice .

• BRCA1 Interaction: Wip1 has been identified as an interactor and substrate of BRCA1, affecting the dynamics of BRCA1 recruitment to chromatin surrounding DNA lesions .

To study these functions using antibodies, researchers can employ:

• Co-immunoprecipitation assays: Using GFP-tagged Wip1 constructs and GFP-Trap beads, or endogenous Wip1 immunoprecipitation with affinity-purified antibodies immobilized on protein A/G resin .

• Phospho-specific antibodies: Utilizing antibodies against phospho-T543-53BP1, phospho-S15-p53, and phospho-S1524-BRCA1 to monitor the dephosphorylation activity of Wip1 .

• Immunofluorescence microscopy: Tracking the formation and resolution of 53BP1 foci in response to ionizing radiation, with particular attention to S-phase cells (EdU+) where Wip1's role in homologous recombination is most evident .

What experimental approaches can demonstrate the role of Wip1 in homologous recombination repair?

Multiple complementary approaches can elucidate Wip1's function in homologous recombination (HR):

• Genetic Manipulation Strategies:

  • CRISPR/Cas9-mediated knockout of WIP1 in cell lines (U2OS, RPE)

  • Complementation with wild-type WIP1 or catalytically inactive D314A mutant

  • Traffic Light Reporter assays to directly measure HR efficiency

• DNA Damage Induction and Monitoring:

  • Exposure to ionizing radiation and measurement of 53BP1 foci persistence

  • Treatment with topoisomerase I inhibitor camptothecin to induce HR-repaired damage

  • Application of DNA crosslinking agents like mitomycin C to assess HR-dependent repair

• Biochemical Analysis:

  • Immunoprecipitation to detect interactions between Wip1 and HR proteins (BRCA1, 53BP1)

  • In vitro dephosphorylation assays using purified Wip1 and phosphorylated substrates

  • Analysis of phosphorylation status of key HR proteins in WIP1-deficient cells

• Functional Readouts:

  • Cell survival assays following genotoxic treatments

  • Quantification of EdU+ cells with persistent 53BP1 foci as HR-deficient

  • Analysis of abnormal mitotic events resulting from unrepaired DNA damage

These approaches collectively demonstrate that loss or inhibition of WIP1 delays the disappearance of radiation-induced 53BP1 foci specifically in S/G2 phase cells and increases sensitivity to HR-dependent DNA damage.

How do researchers analyze the interaction between Wip1 and BRCA1 using antibody-based techniques?

Investigating the Wip1-BRCA1 interaction requires sophisticated antibody-based techniques:

• Co-Immunoprecipitation (Co-IP):

  • Transfect cells with GFP-WIP1 plasmid using polyethylenimine

  • Extract proteins using specialized lysis buffer (50 mM Tris pH 8.0, 120 mM NaCl, 1% Tween-20, 0.1% NP-40, 1.0% glycerol, 2 mM EDTA, 3 mM EGTA, 10 mM MgCl₂, with protease/phosphatase inhibitors)

  • Add benzonase (100 U/mL) and ethidium bromide (50 μg/mL) to disrupt DNA-protein interactions

  • Perform pull-down using GFP-Trap beads or antibodies against endogenous Wip1 immobilized on protein A/G resin

  • Analyze bound proteins by Western blotting for BRCA1

• Phosphorylation Analysis:

  • Use phospho-specific antibodies against BRCA1 (such as phospho-Ser1524-BRCA1)

  • Compare phosphorylation levels in wild-type versus WIP1-knockout cells

  • Perform in vitro dephosphorylation assays with purified components

• Chromatin Recruitment Dynamics:

  • Induce DNA damage with ionizing radiation

  • Perform chromatin fractionation to isolate chromatin-bound proteins

  • Immunoblot for BRCA1 and Wip1 in different cellular fractions

  • Use immunofluorescence to visualize co-localization at DNA damage sites

These techniques have revealed that Wip1 activity is necessary for correct dynamics of BRCA1 recruitment to chromatin flanking DNA lesions, with implications for the choice between non-homologous end joining and homologous recombination repair pathways.

How can researchers utilize Wip1 antibodies to study its role in cancer progression and therapy resistance?

Advanced cancer research applications for Wip1 antibodies include:

• Expression Analysis in Clinical Samples:

  • Immunohistochemical staining of patient tumor samples shows Wip1 is overexpressed in 63.3% of non-small cell lung cancer (NSCLC) tissues compared to 0% in normal tissues (p<0.01)

  • Use antibody-based tissue microarrays to correlate Wip1 expression with clinical outcomes and treatment responses

• Therapeutic Response Prediction:

  • Combine Wip1 antibody staining with PARP inhibitor sensitivity assays

  • Research shows inhibition of Wip1 increases the sensitivity of BRCA1-proficient cancer cells to the PARP inhibitor olaparib

  • Monitor therapy-induced changes in Wip1 expression and activity using phospho-specific antibodies

• Mechanistic Studies:

  • Use phospho-specific antibodies against downstream Wip1 targets (p53-S15, 53BP1-T543) to monitor therapy-induced DNA damage responses

  • Analyze HR pathway activity in Wip1-overexpressing versus Wip1-depleted cancer cells

  • Evaluate combinations of Wip1 inhibitors with conventional chemotherapy or targeted agents

• Biomarker Development:

  • Develop standardized IHC protocols for Wip1 detection in clinical pathology

  • Establish quantitative scoring systems correlating Wip1 expression levels with therapeutic outcomes

  • Combine with other DNA repair pathway markers for comprehensive tumor profiling

These applications highlight Wip1's potential as both a therapeutic target and predictive biomarker in cancer treatment strategies.

What methodological approaches can be used to study the effects of Wip1 inhibition in combination with PARP inhibitors?

Studying Wip1 inhibition in combination with PARP inhibitors requires multifaceted experimental approaches:

• Cell Viability and Proliferation Assays:

  • Treat cells with olaparib alone or in combination with Wip1 inhibitor GSK2830371 (0.5 μM)

  • Assess survival using colony formation assays, which have demonstrated increased sensitivity to olaparib in WIP1-knockout cells

  • Analyze cell cycle progression using flow cytometry (cells treated with olaparib+WIP1i accumulate in G2 phase)

• DNA Damage Assessment:

  • Quantify 53BP1 foci in S/G2 phase cells after combined treatment

  • Monitor γH2AX, RPA2 phosphorylation, and p21 protein levels by Western blotting

  • Analyze frequency of abnormal anaphases in mitotic cells to assess unrepaired DNA damage

• Mechanistic Investigation:

  • Use siRNA-mediated depletion of BRCA1 to determine if increased sensitivity is BRCA1-dependent

  • Generate p21 knockout cell lines to evaluate p21 dependence of observed effects

  • Apply epistasis analysis to determine genetic interactions between WIP1 and PARP pathways

• Molecular Pathway Analysis:

  • Monitor CHK1 and RPA2 phosphorylation (markers of replication stress)

  • Assess p53 pathway activation through p21 induction

  • Track phosphorylation status of Wip1 substrates in response to treatment

This integrated approach has revealed that inhibition of Wip1 allows accumulation of DNA damage in S/G2 cells and increases cancer cell sensitivity to PARP inhibition, potentially broadening the clinical utility of PARP inhibitors beyond BRCA-mutated cancers.

What advanced techniques can be employed to validate the specificity of Wip1 antibodies in complex experimental systems?

Rigorous validation of Wip1 antibodies requires sophisticated techniques to ensure specificity:

• Genetic Knockout Controls:

  • Generate CRISPR/Cas9-mediated WIP1 knockout cell lines as definitive negative controls

  • Example methodology: Transfect cells with pCMV-CAS9-2A-GFP carrying gRNA sequence (tgagcgtcttctccgaccaggg), followed by single-cell sorting of GFP+ cells

  • Validate knockout by Western blotting before using as antibody specificity controls

• siRNA Verification:

  • Transfect cells with Silencer Select siRNA (5 nM) using RNAiMAX

  • Confirm knockdown efficiency by qRT-PCR and Western blotting

  • Use as validation controls for phospho-specific antibodies like pT543-53BP1

• Recombinant Protein Expression Systems:

  • Express full-length and truncated Wip1 proteins in bacterial or mammalian systems

  • Create point mutants (e.g., catalytically inactive D314A mutant)

  • Use purified proteins for peptide competition assays and epitope mapping

• Cross-Reactivity Assessment:

  • Test antibodies against related phosphatases (particularly PP4C which shares substrate specificity)

  • Perform immunoprecipitation-mass spectrometry to identify all proteins recognized by the antibody

  • Conduct Western blots using tissues from multiple species to assess cross-species reactivity

• Application-Specific Validation:

  • For immunofluorescence: Compare staining patterns between wild-type and knockout cells

  • For IHC: Include multiple positive and negative control tissues

  • For phospho-specific antibodies: Treat samples with lambda phosphatase as controls

These validation steps ensure antibody specificity and prevent misinterpretation of experimental results in complex biological systems.

What are common technical challenges when using Wip1 antibodies, and how can researchers address them?

Researchers commonly encounter several technical challenges when working with Wip1 antibodies:

• Low Signal Intensity in Western Blots:

  • Challenge: Wip1's moderate expression levels can result in weak signals

  • Solution: Optimize protein extraction using specialized buffers containing benzonase and brief sonication

  • Increase primary antibody concentration (1:200 dilution) and extend incubation time to overnight at 4°C

  • Use enhanced chemiluminescence detection systems with extended exposure times

• Non-specific Bands:

  • Challenge: Some antibodies detect non-specific proteins of similar molecular weight

  • Solution: Include WIP1 knockout cell lysates as negative controls

  • Use gradient gels (4-12%) for better separation around the 66.7 kDa region

  • Verify band identity using siRNA knockdown experiments

• Inconsistent Immunohistochemistry Results:

  • Challenge: Variable staining patterns between samples

  • Solution: Standardize fixation procedures and section thickness (4 μm recommended)

  • Implement consistent antigen retrieval methods (trypsin treatment for 18 minutes)

  • Establish clear positive staining criteria (>10% cells with yellow/brown staining)

• Detection of Phosphorylated Targets:

  • Challenge: Rapid dephosphorylation during sample processing

  • Solution: Add phosphatase inhibitors immediately during cell lysis

  • Process samples rapidly at 4°C to preserve phosphorylation status

  • Include phosphatase-treated controls to verify phospho-antibody specificity

• Differential Isoform Detection:

  • Challenge: Antibodies may preferentially detect certain Wip1 isoforms

  • Solution: Use antibodies targeting conserved regions when total Wip1 detection is desired

  • Verify which isoforms are detected by your antibody using recombinant protein standards

How should researchers interpret discrepancies in Wip1 detection between different antibody-based methods?

When confronted with discrepancies between different detection methods, researchers should implement a systematic interpretation approach:

• Method-Specific Limitations Assessment:

  • Western blot detects denatured proteins and may miss conformational epitopes

  • IHC preserves spatial information but may suffer from epitope masking during fixation

  • Immunofluorescence offers subcellular localization but may have lower sensitivity

  • ELISA provides quantitative data but lacks spatial information

• Epitope Accessibility Analysis:

  • Different antibodies target different epitopes that may be differentially accessible

  • Post-translational modifications may mask epitopes in certain contexts

  • Protein-protein interactions in intact cells may conceal antibody binding sites

• Cross-Validation Strategies:

  • Confirm key findings using at least two independent antibodies targeting different epitopes

  • Complement antibody-based detection with functional assays (e.g., phosphatase activity)

  • Validate with genetic approaches (siRNA, CRISPR/Cas9) to confirm specificity

• Reconciliation Framework:

  Detection Method	Strengths	Limitations	Best Applications
  Western Blot	Quantitative, size verification	Loses spatial information	Expression level comparisons
  IHC	Preserves tissue architecture	Variable staining intensity	Patient sample analysis
  Immunofluorescence	Subcellular localization	Background autofluorescence	Colocalization studies
  ELISA	High-throughput quantification	No size verification	Screening applications

• Biological Interpretation:

  • Consider context-dependent regulation of Wip1 expression and localization

  • Evaluate role of post-translational modifications in epitope recognition

  • Account for technical variables (fixation methods, antibody clones) when comparing across studies

What quality control measures are essential when using phospho-specific antibodies to study Wip1-mediated dephosphorylation events?

Phospho-specific antibody experiments require rigorous quality control measures:

• Antibody Validation Controls:

  • Validate phospho-antibody specificity using siRNA against the target protein

  • Confirm using both immunofluorescence and Western blotting techniques

  • Include phosphatase-treated samples as negative controls

• Signal Induction Verification:

  • Demonstrate appropriate induction of phosphorylation signal after DNA damage

  • Use ionizing radiation (IR) to induce phosphorylation of T543-53BP1 and other Wip1 targets

  • Show time-dependent changes in phosphorylation status

• Phosphatase Inhibitor Controls:

  • Process samples with and without phosphatase inhibitors to demonstrate their necessity

  • Include lambda phosphatase-treated controls to confirm phospho-antibody specificity

  • Use calyculin A or okadaic acid as PP2C family phosphatase inhibitors when appropriate

• In Vitro Dephosphorylation Assays:

  • Perform in vitro dephosphorylation assays using purified components

  • Demonstrate efficient dephosphorylation of 53BP1 at T543 by Wip1 in vitro

  • Use catalytically inactive Wip1 mutant (D314A) as negative control

• Genetic Complementation:

  • Show that phenotypes in WIP1 knockout cells can be rescued by wild-type Wip1 but not catalytically inactive D314A mutant

  • Demonstrate that complementation normalizes phosphorylation patterns of target proteins

  • Establish clear correlation between Wip1 phosphatase activity and observed effects

• Quantification Standards:

  • Use densitometry with appropriate housekeeping controls for Western blots

  • For immunofluorescence, establish objective quantification criteria (e.g., foci number per nucleus)

  • Employ automated image analysis software to reduce observer bias

These quality control measures ensure reliable interpretation of phosphorylation dynamics in Wip1-related experiments.

How is Wip1 expression analyzed in clinical cancer samples and what are the technical considerations?

Analysis of Wip1 expression in clinical cancer samples involves specific technical considerations:

• Tissue Processing and Preservation:

  • Both fresh-frozen and formalin-fixed paraffin-embedded (FFPE) tissues can be used

  • For Western blot analysis, extract proteins from fresh tissues using RIPA buffer

  • For FFPE samples, prepare 4-μm sections for immunohistochemistry

• Immunohistochemical Protocol Optimization:

  • Perform proper antigen retrieval with trypsin treatment (18 minutes)

  • Block endogenous peroxidase with 3% hydrogen peroxide (12 minutes)

  • Use 10% goat serum as blocking agent before antibody application

  • Apply rabbit anti-human Wip1 monoclonal antibody at 1:100 dilution

  • Incubate at 4°C overnight for optimal staining

• Scoring and Interpretation:

  • Establish clear positivity criteria (>10% of cells showing yellow/brown staining is considered positive)

  • Have two independent pathologists score slides to minimize subjective bias

  • Consider automated image analysis systems for objective quantification

• Validation Across Sample Types:

  • Compare results between different cancer types and normal tissues

  • Research has shown significantly higher Wip1 expression in NSCLC (63.3%) compared to normal tissues (0%, p<0.01)

  • Correlate IHC results with Western blot analysis when feasible

• Clinical Correlation Analysis:

  • Correlate Wip1 expression with clinical parameters (stage, grade, survival)

  • Compare with expression of related proteins (p53, p38, p16) for pathway analysis

  • Apply appropriate statistical methods for clinical significance assessment

These methodological considerations ensure reliable and reproducible analysis of Wip1 expression in clinical cancer samples, facilitating its potential use as a biomarker.

What experimental approaches can determine if Wip1 is a suitable therapeutic target in specific cancer types?

Determining Wip1's suitability as a therapeutic target requires multifaceted experimental approaches:

• Target Validation Studies:

  • Analyze Wip1 expression across cancer types using tissue microarrays and IHC

  • Perform genetic knockdown/knockout studies using siRNA, shRNA, or CRISPR/Cas9

  • Assess effects on cancer cell proliferation, survival, and therapy resistance

• Pharmacological Inhibition:

  • Utilize specific Wip1 inhibitors such as GSK2830371 (WIP1i) at 0.5 μM concentration

  • Compare effects between cancer cells and normal cells to establish therapeutic window

  • Evaluate dose-response relationships and maximum tolerated doses

• Combination Therapy Assessment:

  • Test Wip1 inhibition in combination with DNA-damaging agents (radiation, camptothecin)

  • Evaluate synergy with targeted therapies like PARP inhibitors (olaparib)

  • Research shows WIP1 knockout or inhibition increases sensitivity to both IR and camptothecin

• Mechanistic Biomarker Identification:

  • Monitor p53 pathway activation via p21 induction and p53-S15 phosphorylation

  • Track DNA damage response through γH2AX and 53BP1 foci formation

  • Evaluate BRCA1 recruitment dynamics to predict HR deficiency phenotypes

• In Vivo Model Validation:

  • Develop xenograft models with Wip1-overexpressing tumors

  • Assess tumor growth inhibition with Wip1 inhibitors alone or in combination

  • Analyze pharmacodynamic biomarkers in tumor samples

• Patient-Derived Models:

  • Use patient-derived xenografts or organoids to evaluate Wip1 targeting

  • Correlate response with molecular profiles of the original tumors

  • Identify predictive biomarkers of response to Wip1 inhibition

These approaches have revealed that inhibition of Wip1 increases sensitivity to PARP inhibitors even in BRCA1-proficient cancer cells, suggesting potential therapeutic applications beyond BRCA-mutated cancers .

How can researchers study the relationship between Wip1 and other DNA damage response proteins using advanced antibody-based techniques?

Advanced antibody-based techniques enable sophisticated analysis of Wip1's interactions with DNA damage response proteins:

• Proximity Ligation Assay (PLA):

  • Detect protein-protein interactions between Wip1 and partners (BRCA1, 53BP1) in situ

  • Visualize interaction dynamics following DNA damage induction

  • Quantify changes in interaction frequency in different cell cycle phases

• Sequential Chromatin Immunoprecipitation (Re-ChIP):

  • First immunoprecipitate with anti-Wip1 antibodies

  • Re-immunoprecipitate with antibodies against interaction partners

  • Identify genomic regions where both proteins co-occupy chromatin

• FRET/FLIM Analysis:

  • Tag Wip1 and interaction partners with appropriate fluorophores

  • Measure Förster resonance energy transfer to confirm direct interactions

  • Analyze dynamics of interactions in live cells following DNA damage

• Immunoprecipitation-Mass Spectrometry:

  • Perform IP using GFP-tagged Wip1 or endogenous Wip1 antibodies

  • Add benzonase (100 U/mL) and ethidium bromide (50 μg/mL) to disrupt DNA-mediated interactions

  • Identify interaction partners through mass spectrometry

  • Validate key interactions through reciprocal co-IPs

• Multiplexed Immunofluorescence:

  • Simultaneously detect multiple proteins in the same sample

  • Analyze co-localization of Wip1 with DNA damage markers (γH2AX, 53BP1)

  • Quantify spatial relationships between proteins at damage sites

  • Track temporal dynamics of protein recruitment/removal

• Phospho-Specific Antibody Arrays:

  • Create custom antibody arrays targeting known Wip1 substrates

  • Compare phosphorylation profiles between wild-type and WIP1-depleted cells

  • Identify novel Wip1 targets by screening for phosphorylation changes

Research using these techniques has demonstrated that Wip1 interacts with 53BP1 in an IR-dependent manner, while its interaction with BRCA1 appears more constitutive . Furthermore, Wip1 has been shown to dephosphorylate 53BP1 at Threonine 543, affecting its interaction with RIF1 and influencing DNA repair pathway choice .