Norovirus Group-2 P-Domain
Description
Introduction to Norovirus Group-2 P-Domain
The Norovirus Group-2 P-Domain is a critical structural component of the viral capsid protein VP1, responsible for receptor binding, host-cell interactions, and immune evasion. It spans residues 225–520 of the VP1 capsid protein and is divided into two subdomains: P1 (residues 226–278 and 406–520) and P2 (residues 278–406). The P2 subdomain exhibits high sequence variability and forms the outermost surface-exposed region, making it central to strain-specific antigenicity and histo-blood group antigen (HBGA) binding .
Domain Architecture
Stability and Assembly
-
Thermal/pH Stability: P dimers remain stable across pH 2–11 and under denaturing conditions .
-
P-Particle Formation: Engineered P domains lacking the hinge region self-assemble into 12-dimer particles with 700-fold enhanced HBGA binding affinity compared to dimers .
Functional Role in Receptor Binding
The P-Domain mediates attachment to HBGAs, which are critical for norovirus infectivity:
-
Binding Specificity: Strain-dependent recognition of A/B/O HBGA types via a conserved RGD-like motif (residues 288–290 in GII.4 strains) and adjacent variable residues (e.g., N302, T337, Q375) .
-
Key Mutations: Single amino acid changes in the P2 domain (e.g., E302→N in MOH strain) alter HBGA binding patterns .
Table 1: HBGA Binding Patterns of Select Norovirus Strains
| Strain | HBGA Binding Specificity | Key P2 Domain Residues |
|---|---|---|
| VA387 | A, B, O secretors | RGD motif (288–290), N302, T337 |
| MOH | A, B secretors | RGK motif (288–290), E302, N338 |
| GII.17 | Broadly recognizes HBGAs (post-2014) | Insertions at 378/397, 22 surface-exposed changes |
Antigenic Variation and Immune Evasion
-
Epidemic Emergence: Hypervariable regions in P2 (e.g., residues 296–298 and 393–395) correlate with GII.4 strain dominance (e.g., 2002 and 2006 epidemics) .
-
Epitope Mapping: Surface-exposed loops in P2 are targets for neutralizing antibodies, but rapid mutations enable immune escape .
Vaccine and Therapeutic Development
-
P-Particle Advantages: High-yield bacterial expression, strong immunogenicity, and stability make P particles promising vaccine candidates .
-
Recombinant Protein Use: ProSpec Bio’s Norovirus Group-2 P-Domain (Catalogue NRV-216) is a 30 kDa protein fused to a 6xHis tag, used for HBGA interaction studies .
Key Experimental Data
Table 2: Primers Used in P-Domain Construct Generation
| Primer | Sequence (5′→3′) | Enzyme | Construct Target |
|---|---|---|---|
| P422 | GCACGGATCCTTCTTGGTGCCACCCACAGTT | BamHI | P domain |
| P409 | AGTCAGCGGCCGCTTATAATGCACGTCTGCGCCC | NotI | P domain |
Product Specs
Human norovirus is a common cause of gastroenteritis, categorized into two groups. Norwalk virus, discovered in 1968, belongs to group 1. This virus leads to symptoms like vomiting, diarrhea, and nausea. The CDC estimates 19-21 million annual norovirus infections in the US, resulting in 800 deaths. Globally, it impacts around 267 million people, causing over 200,000 deaths, primarily in developing nations and vulnerable populations. Most cases resolve within a few days. Norovirus is highly contagious, spreading through contaminated food, water, or surfaces. Outbreaks peak in January, occurring mainly between November and April. This positive-sense RNA virus has a 7.5 kb genome encoding a major structural protein, VP1 (50-55kDa). VP1's structure comprises the N-terminal, Hinge, shell (S), and protruding (P) domains. The P domain (amino acids 225-520) forms a P1-P2-P1 structure and contains a receptor-binding region for human histo-blood group antigens (HBGAs). When expressed in bacteria, the P domain can form a P dimer and a P particle (12 P dimers). The P particle exhibits higher HBGA binding affinity than the virus-like particle (VLP) formed by the full-length capsid, making it a promising candidate for norovirus vaccine development.
This recombinant Norovirus Group-2 Capsid P-Domain, derived from E. coli strain VA387, consists of amino acids 225-520 and has a molecular weight of 30kDa. A 6xHis tag is fused to the N-terminal for purification using chromatography. The P-domain (225-520 a.a.) forms a P1-P2-P1 structure and possesses a receptor-binding region for recognizing human histo-blood group antigens (HBGAs). When expressed in bacteria, the P-domain can spontaneously form a P dimer and a P particle composed of 12 P dimers. This P-particle exhibits an enhanced binding affinity for HBGAs compared to the virus-like particle (VLP) formed by the full-length capsid.
The solution is formulated with a phosphate buffer and 17mM potassium carbonate (K2CO3).
For short-term storage, the Recombinant Norovirus Group-2 P-Domain remains stable at 4°C for up to one week. However, for long-term storage, it is recommended to store the protein below -18°C. Repeated freezing and thawing of the protein should be avoided.
Q&A
What is the basic structure of the norovirus Group-2 P-domain?
The P-domain (protruding domain) forms the arch-like structures extending from the shell (S domain) of the norovirus capsid. It can be further divided into P1 and P2 subdomains, with the P2 subdomain (amino acids 275-405) containing the most variable sequence and being located on the surface of the capsid. The P domain connects to the S domain via an 8-amino acid hinge region. In Group-2 noroviruses (particularly GII.4), the P-domain forms stable dimers that are critical for receptor interactions and antigenic properties .
How does the P-domain function in viral infection?
The P-domain plays a crucial role in binding to human histo-blood group antigens (HBGAs), which serve as attachment factors or receptors for norovirus. This interaction is believed to be a primary step in norovirus infection. The P-domain contains a receptor binding pocket that is responsible for the specific recognition of different HBGA types. This binding specificity contributes to the strain-specific infectivity patterns observed with different norovirus variants. For example, individuals with blood types A, B, or O secretors are susceptible to certain strains like VA387, while other strains like MOH may only infect type A and B secretors .
What is the relationship between the S domain and P domain in norovirus capsid assembly?
The S domain (residues 1-217) is responsible for forming the interior shell of the norovirus capsid and is required for capsid assembly. It participates in multiple intermolecular interactions including dimers, trimers, and pentamers. In contrast, the P domain (residues 226-530) extends from the shell and is primarily involved in dimeric interactions. When expressed separately, the S domain can form small, thin-layer virus-like particles (VLPs) but lacks receptor binding capability. The P domain alone does not form VLPs but retains its ability to bind to HBGAs with the same pattern as the intact viral capsid .
What expression systems are effective for producing norovirus P-domain proteins?
Two primary expression systems have proven effective for norovirus P-domain production:
-
Baculovirus-Insect Cell System:
-
Advantages: Produces properly folded protein with post-translational modifications
-
Limitations: Lower yield compared to bacterial systems
-
Application: Often used for complete capsid or VLP production
-
-
E. coli Expression System:
-
Advantages: High yield, simpler procedures, cost-effective
-
Method: P domain coding sequences can be cloned into vectors like pGEX-4T-1
-
Purification: GST-fusion proteins can be purified using glutathione-Sepharose 4B columns
-
Application: Ideal for producing isolated P-domains for binding studies
-
The E. coli system provides particularly high yields and easier production of recombinant P protein, making it preferable for many structural and binding studies .
What techniques are most reliable for measuring P-domain-glycan binding affinities?
There are several biophysical techniques used to measure P-domain-glycan binding affinities, but they show inconsistencies in reported values:
| Technique | Advantages | Limitations | Notes |
|---|---|---|---|
| NMR Spectroscopy | Provides structural and dynamic information; Can detect weak interactions | Requires large quantities of isotopically labeled protein | May not detect binding that MS detects in the same system |
| Mass Spectrometry (MS) | High sensitivity; Small sample requirements | May detect non-specific interactions | Reports different binding affinities compared to NMR |
| X-ray Crystallography | Provides atomic-resolution structures of complexes | Static picture; Crystal packing effects | Best for structural confirmation of binding sites |
| Surface Plasmon Resonance | Real-time kinetics; Label-free detection | Surface immobilization may affect binding | Useful for comparing relative binding strengths |
For the most reliable results, a combination of MS techniques and NMR experiments is recommended to provide comprehensive insights into HBGA binding by norovirus capsid proteins .
How can researchers effectively study P-domain dimer dissociation kinetics?
Different techniques are required for human versus murine norovirus P-domains due to their drastically different dissociation rates:
-
For Murine Norovirus (MNV-1) P-dimers:
Global line shape analysis of monomer and dimer cross-peaks in concentration-dependent methyl TROSY NMR spectra can yield dissociation rate constants (k_off of approximately 1 s⁻¹) . -
For Human Norovirus (HuNoV) GII.4 P-dimers:
Due to their extremely slow dissociation (k_off ≈ 10⁻⁶ s⁻¹), ion-exchange chromatography is more appropriate. NMR and native mass spectrometry can directly detect P-domain monomers in solution for murine but not for human norovirus, confirming the significant stability difference .
What is known about the HBGA binding pocket in the norovirus GII.4 P-domain?
The HBGA binding pocket in the GII.4 P-domain has been extensively characterized through computational analysis, site-directed mutagenesis, and X-ray crystallography:
-
Composition: The binding pocket consists of an RGD-like motif at the bottom and three strain-specific binding sites surrounding this motif .
-
Critical Residues: Specific amino acids like threonine 302 (T302) in strain VA387 are essential for binding; mutation of this single residue to alanine results in complete loss of binding to A, B, and H antigens .
-
Binding Mechanism: Many HBGA binding interactions are complex, involving capsid loop movements, alternative HBGA conformations, and HBGA rotations .
-
Loop Flexibility: A loop (residues 391-395) can be repositioned to accommodate different Lewis HBGA types. For example, this loop shifts to allow binding of Lewis Y and provides direct hydrogen- and water-mediated bonds with Lewis B .
High-resolution X-ray crystal structures of P domains from epidemic GII.4 variants from 2004, 2006, and 2012 cocrystallized with various HBGA types have provided detailed insights into these binding mechanisms .
How do bile acids affect norovirus P-domain stability and function?
Bile acids, particularly glycochenodeoxycholic acid (GCDCA), have distinct effects on murine versus human norovirus P-domains:
-
MNV-1 P-domains: GCDCA binding stabilizes MNV-1 P-domain dimers and induces long-range NMR chemical shift perturbations (CSPs) within loops involved in antibody and receptor binding. These CSPs likely reflect conformational changes in the P-domain structure .
-
HuNoV P-domains: While structurally similar to MNV P-domains, HuNoV GII.4 P-dimers have a much slower dissociation rate (approximately 10⁻⁶ s⁻¹ compared to 1 s⁻¹ for MNV). This suggests fundamental differences in the role of GCDCA as a cofactor for MNV and HuNoV infection .
Understanding these differences may provide insights into the varied requirements for bile acids during infection with different norovirus strains.
How do different HBGA types interact with the P-domain of GII.4 noroviruses?
GII.4 noroviruses can bind to multiple HBGA types with distinct binding patterns and mechanisms:
| HBGA Type | Binding Characteristics | Structural Adaptations |
|---|---|---|
| H Type 2 | Primary binding target for many strains | Canonical binding to the conserved pocket |
| Lewis Y | Complex binding interaction | Requires repositioning of loop (residues 391-395) |
| Lewis B | Forms direct hydrogen and water-mediated bonds | Slight shift in the flexible loop |
| Lewis A | Variable binding across strains | May involve strain-specific adaptations |
| Lewis X | Variable binding across strains | May involve strain-specific adaptations |
| A Type | Recognized by strains like VA387 | Requires specific binding pocket configuration |
| B Type | Recognized by strains like VA387 | Requires specific binding pocket configuration |
The ability of GII.4 noroviruses to bind various Lewis HBGAs, combined with their temporal amino acid modifications, may explain their dominance in outbreaks over the past decade .
How do P-domain sequences vary among different GII.4 epidemic variants?
GII.4 noroviruses evolve approximately every two years, producing new epidemic variants with modified HBGA binding interactions. Analysis of P-domain sequences from GII.4 variants from 2004, 2006, and 2012 reveals:
These variations influence receptor binding preferences and antigenic properties, contributing to the continued emergence of epidemic strains .
How do P-domain characteristics differ between murine and human noroviruses?
Despite structural similarities, murine and human norovirus P-domains exhibit significant functional differences:
| Characteristic | Murine Norovirus (MNV) | Human Norovirus (HuNoV) |
|---|---|---|
| P-dimer stability | Less stable (k_off ≈ 1 s⁻¹) | Highly stable (k_off ≈ 10⁻⁶ s⁻¹) |
| Monomer detection | Directly detectable by NMR and MS | Not detectable as monomers in solution |
| Bile acid effect | GCDCA stabilizes P-dimers | Different role as cofactor |
| Binding partners | Different glycan specificity | Primarily HBGAs |
| Experimental tractability | More amenable to cell culture and animal models | Limited cell culture systems |
These differences suggest distinct evolutionary adaptations despite shared structural features and may explain some of the challenges in developing unified models of norovirus infection .
How can researchers address contradictions in reported P-domain-glycan binding affinities?
The inconsistencies in reported binding affinities between different biophysical techniques can be addressed through:
-
Technique Complementarity: Combining multiple orthogonal techniques (NMR, MS, SPR, ITC) to cross-validate binding measurements
-
Standardized Conditions: Ensuring consistent buffer compositions, pH, temperature, and protein concentrations across experiments
-
Multivalency Considerations: Accounting for potential avidity effects when comparing monomeric glycans to multivalent presentations
-
Native Context Representation: Developing experimental setups that better mimic the presentation of HBGAs on cellular surfaces
-
Quantitative Analysis: Employing robust statistical methods to analyze binding data and establish confidence intervals
When designing experiments, researchers should recognize the fundamental differences between techniques and interpret results accordingly to avoid mischaracterizing binding interactions .
What strategies can improve P-domain protein engineering for structural studies?
Advanced protein engineering strategies for norovirus P-domain structural studies include:
-
Domain Boundary Optimization:
-
Include the complete hinge region (8 amino acids) linking S and P domains
-
For isolated P domains, ensure inclusion of residues 226-530
-
When focusing on P2 subdomain, preserve key stabilizing interactions with P1
-
-
Stabilization Approaches:
-
Introduce disulfide bonds to stabilize dimeric interfaces
-
Consider fusion partners that promote dimerization
-
Engineer constructs with ligands known to stabilize the native conformation
-
-
Crystallization Enhancements:
-
Surface entropy reduction mutations at flexible loops not involved in binding
-
Co-crystallization with binding partners (HBGAs, antibody fragments, bile acids)
-
Utilize nanobodies as crystallization chaperones for challenging constructs
-
These strategies can improve protein stability, solubility, and crystallizability for high-resolution structural studies .
What are the current challenges in developing P-domain-based diagnostic tools?
Developing diagnostic tools based on norovirus P-domains faces several research challenges:
-
Strain Diversity: The genetic and antigenic diversity of circulating norovirus strains requires either strain-specific reagents or broadly reactive ones
-
Stability Requirements: Maintaining the proper folding and dimeric state of P-domains under storage and assay conditions remains challenging
-
Assay Sensitivity: Determining the optimal balance between sensitivity and specificity for clinical relevance
-
Production Scalability: While E. coli-based expression systems provide high yields, ensuring consistent quality and proper folding at scale remains difficult
-
Validation Standards: Establishing appropriate positive and negative controls for assay validation when infectious virus cultivation is limited
Addressing these challenges requires interdisciplinary approaches combining structural biology, biochemistry, and clinical virology perspectives .
Product Science Overview
Noroviruses (NoVs) are a group of single-stranded, positive-sense RNA viruses belonging to the Caliciviridae family. They are the leading cause of viral acute gastroenteritis worldwide, affecting millions of people annually. Noroviruses are divided into two major genogroups, GI and GII, with GII.4 being the predominant genotype responsible for the majority of outbreaks .
The norovirus capsid is primarily composed of a major structural protein known as VP1, which is approximately 60 kDa in size. This protein is responsible for forming the viral capsid and is encoded by the viral genome. The capsid protein is divided into two main domains: the shell (S) domain and the protruding (P) domain .
The P-domain is further subdivided into two subdomains, P1 and P2. The P2 subdomain is particularly important as it contains the most variable sequences and is located on the surface of the capsid. This subdomain plays a crucial role in immune recognition and receptor interaction .
The P-domain forms dimers and binds to histo-blood group antigens (HBGAs), which are recognized as receptors or attachment factors for noroviruses. This interaction is essential for the virus’s ability to infect host cells .
Studies have shown that the P-domain dimers exhibit broad specificity for HBGAs and bind to various oligosaccharides with different affinities. This binding is influenced by the type and structure of the HBGAs . The high yield and easy production of recombinant P-domain proteins make them ideal for research purposes.
Further research on the P-domain can provide valuable insights into the mechanisms of norovirus infection and aid in the development of effective vaccines and antiviral treatments .
