NSA2 Antibody

What are the confirmed applications for NSA2 antibody in research settings?

NSA2 antibody has been validated for Western blotting (WB) and ELISA applications in research settings . For Western blotting, NSA2 antibody has been successfully used at concentrations of 0.4 μg/mL on various cell lysates, including human cell lines (HeLa, HEK-293T, Jurkat) and mouse cell lines (TCMK-1, NIH/3T3) . When designing experiments, it's advisable to begin with the manufacturer's recommended dilution and optimize based on your specific sample type and detection system. For applications beyond WB and ELISA, thorough validation is necessary as these have not been as extensively documented in the literature.

What is the optimal sample preparation protocol for NSA2 antibody in Western blotting?

For optimal results with NSA2 antibody in Western blotting, lysates should be prepared using NETN lysis buffer . The standard protocol involves:

• Harvesting cells at 70-80% confluence

• Washing with cold PBS

• Lysing with NETN buffer containing protease inhibitors

• Incubating on ice for 30 minutes with occasional vortexing

• Centrifuging at 12,000g for 15 minutes at 4°C

• Collecting supernatant and determining protein concentration

Loading approximately 50 μg of total protein per lane has shown successful detection of NSA2 protein in multiple cell types . The protein typically appears at approximately 29 kDa on immunoblots, consistent with its predicted molecular weight .

To ensure antibody specificity, implement these validation approaches:

• Peptide competition assay: Use the NSA2 N-terminal peptide (QNEYIELHRK RYGYRLDYHE KKRKKESREA HERSKKAKKM IGLKAKLYHK) as a blocking agent . Pre-incubation of the antibody with this peptide should abolish specific signals.

• Knockdown/knockout controls: Compare signal between wild-type cells and those with NSA2 knockdown or knockout. Complete signal elimination in knockout samples confirms specificity.

• Multiple antibody validation: Use antibodies from different sources targeting different NSA2 epitopes to confirm consistent detection patterns.

• Cross-reactivity assessment: Test against similar proteins, particularly other ribosome biogenesis factors, to ensure signals are specific to NSA2.

How can NSA2 antibody be used to investigate the NSA2-GFM2 co-regulation in ribosomal biogenesis?

Recent research has established a co-regulation relationship between NSA2 and GFM2 (GTP-dependent ribosome recycling factor mitochondrial 2), providing a molecular link between ribosomal processes . When designing experiments to investigate this relationship:

• Co-expression analysis: Use NSA2 antibody alongside GFM2 antibody in Western blot analysis of samples under various conditions to establish correlation patterns. Quantitative PCR can complement this approach, as demonstrated with primers:

  • hGFM2 F2: AGTTCTCCATGACAAGCAGCG

  • hGFM2 R2: GTTGGTCAGCAAACGGCAA

  • hNSA2 F6: AGAAGGCGGGAAAATGGGAAG

  • hNSA2 R6: ATTGGTAGGCAAAAGGTGGCT

• Co-immunoprecipitation: Use NSA2 antibody for pull-down experiments followed by GFM2 detection to investigate potential physical interactions.

• Subcellular co-localization: Employ immunofluorescence with both antibodies to assess spatial relationships during various stages of ribosome biogenesis.

• Response to perturbation: Analyze how both proteins respond to inhibitors of ribosome biogenesis, metabolic stress, or hyperglycemic conditions to understand functional relationships.

What methodological approaches can resolve conflicting data about NSA2 subcellular localization?

NSA2 has been reported to shuttle between cytosol and nucleus during ribosomal biogenesis , which may explain conflicting localization data in the literature. To resolve these inconsistencies:

• Time-course analysis: Use subcellular fractionation followed by Western blotting with NSA2 antibody at multiple time points during cell cycle progression.

• Live-cell imaging: Create fluorescently tagged NSA2 constructs validated against antibody detection patterns to track movement in real-time.

• Condition-specific localization: Compare NSA2 localization under normal conditions versus stress conditions, particularly examining TGF-β1 stimulation, which has been shown to induce nuclear translocation .

• Co-localization studies: Perform dual immunofluorescence with NSA2 antibody and markers for nucleolus, pre-ribosomal particles, and mature ribosomes.

• Super-resolution microscopy: Use techniques like STORM or PALM with NSA2 antibody to achieve nanometer-scale resolution of localization patterns.

How can NSA2 antibody be utilized in studying diabetic nephropathy mechanisms?

NSA2 has been identified as a biomarker for diabetic nephropathy with elevated expression associated with proteinuria independent of glomerular filtration rate . To investigate its role:

• Expression analysis in diabetic models: Use NSA2 antibody to quantify protein levels in kidney tissues from diabetic animal models compared to controls. Focus on glomerular and tubular cells where NSA2 is abundantly expressed.

• TGF-β1 pathway connection: Design experiments that investigate the relationship between TGF-β1 signaling and NSA2 expression. Previous research has shown that exogenous TGF-β1 increases NSA2 mRNA/protein expression and induces translocation of cytosolic NSA2 to the nucleus in human mesangial cells (HMCs) and HEK293 cells .

• Intervention studies: Use NSA2 antibody to measure protein levels after therapeutic interventions in diabetic models to assess correlation with disease improvement.

• Mechanistic investigations: Combine NSA2 knockdown with TGF-β1 pathway analysis, as NSA2 knockdown has been shown to block TGF-β1-induced pathways .

What are the recommended approaches for studying NSA2's role in the quality control of pre-60S particles?

NSA2 plays a role in the quality control of pre-60S ribosomal particles . To investigate this function:

• Co-immunoprecipitation with pre-60S components: Use NSA2 antibody to pull down associated complexes, followed by mass spectrometry to identify interacting partners.

• Ribosome profiling: Compare ribosome assembly intermediates in control versus NSA2-depleted cells using sucrose gradient centrifugation followed by Western blotting with NSA2 antibody.

• Structural studies: Use NSA2 antibody for immunogold electron microscopy to precisely localize NSA2 within pre-ribosomal particles.

• Functional assays: Design reporter systems to measure translation efficiency and fidelity in cells with modulated NSA2 levels, using the antibody to confirm knockdown or overexpression.

How should researchers address inconsistent NSA2 antibody signals in Western blotting?

If experiencing variable or weak signals when using NSA2 antibody:

• Sample preparation optimization: Ensure complete protein extraction using NETN lysis buffer as recommended . Add phosphatase inhibitors if studying phosphorylation states.

• Blocking optimization: Test different blocking agents (BSA vs. non-fat milk) as NSA2 detection may be sensitive to blocking conditions.

• Antibody concentration titration: Perform a dilution series from 0.2-1.0 μg/mL to determine optimal antibody concentration for your specific samples.

• Signal enhancement techniques: Consider using signal amplification systems or highly sensitive ECL substrates for detecting low abundance NSA2.

• Protein loading: Increase loading to 50-75 μg total protein per lane, as used in validated protocols .

What experimental controls are essential when studying NSA2 in disease models?

When investigating NSA2 in disease contexts such as diabetic nephropathy:

• Positive controls: Include samples with known NSA2 expression (e.g., HEK293T cells) .

• Negative controls: Use NSA2 knockdown samples or tissues from organs with minimal NSA2 expression.

• Disease progression controls: Include samples representing different stages of disease progression to establish correlation patterns.

• Treatment controls: When studying interventions, include appropriate vehicle controls and dose-response analyses.

• Pathway validation: Include controls for TGF-β1 pathway activation/inhibition when studying NSA2 in diabetic nephropathy .

How can NSA2 antibody be used to investigate the relationship between ribosome biogenesis and cellular stress responses?

Recent research suggests connections between ribosome biogenesis factors like NSA2 and cellular stress responses. To investigate these relationships:

• Stress induction experiments: Expose cells to various stressors (oxidative stress, ER stress, nutrient deprivation) and quantify NSA2 levels and localization using the antibody.

• Hyperglycemic models: As NSA2 expression increases under hyperglycemic conditions , design glucose concentration gradient experiments to determine threshold effects.

• TGF-β1 signaling: Design dose-response and time-course experiments with TGF-β1 treatment, measuring NSA2 protein levels and subcellular distribution changes.

• Multi-omics integration: Combine NSA2 protein quantification using the antibody with transcriptomic and metabolomic analyses to build comprehensive models of ribosome biogenesis adaptation to stress.