OR7C1 Antibody

Shipped with Ice Packs
In Stock

Description

Definition and Biological Context

OR7C1 antibody detects the OR7C1 protein, a seven-transmembrane olfactory receptor expressed in non-olfactory tissues such as testes and cancers. OR7C1 is a cancer/testis antigen selectively expressed in CSCs of oral squamous cell carcinoma (OSCC) and colorectal cancer (CRC) . CSCs drive tumor recurrence, metastasis, and therapy resistance due to their self-renewal and drug-efflux capabilities .

Key Validation Steps

  1. IHC Staining: OR7C1 expression was assessed in 13 OSCC biopsies, revealing high expression in 61.5% of cases .

  2. siRNA Knockdown: OR7C1-specific siRNAs reduced stemness markers (SOX2, Nanog, POU5F1) and inhibited sphere formation in HSC-2 cells .

  3. RT-qPCR Primers: Validated primers for OR7C1 and stemness markers (Table 1) .

Table 1: Primer Sequences for OR7C1 and Stemness Markers

GeneForward Primer (5’→3’)Reverse Primer (5’→3’)
OR7C1AGCTCTGTGGACTGCTGGTTGGACGCCAGTTGCAAAGTAT
SOX2GCTACAGCATGATGCAGGACCATCTGCGAGCTGGTCATGGAGTT
NanogGCTGAGATGCCTCACACGGAGTCTGTTTCTTGACCGGGACCTTGTC
POU5F1TGGAGAAGGAGAAGCTGGAGCAAAAGGCAGATGGTCGTTTGGCTGAATA

OR7C1 Expression in Cancer vs. Normal Tissues

  • TCGA/GTEx Data: OR7C1 mRNA levels (FPKM-UQ) were elevated in 57.5% of OSCCs and CRCs compared to normal tissues (testes: mean = 6.199; OSCC: mean = 7.8) .

  • Selectivity: Expressed in CSCs (CD44+/CD133+ populations) but absent in non-CSCs and most normal tissues .

Table 2: OR7C1 Expression Across Tissues

Tissue TypeMean FPKM-UQ (OR7C1)Clinical Relevance
Testes (Normal)6.199Baseline expression
Oral SCC7.857.5% of cases >8 FPKM-UQ
Colon Cancer7.5Poor prognosis marker

Functional Role in CSCs

  • Stemness Maintenance: OR7C1 knockdown reduced SOX2, Nanog, and POU5F1 expression by 60–80% and decreased sphere-forming capacity .

  • Tumorigenicity: OR7C1+ colon CICs showed 3× higher tumorigenicity in xenograft models than OR7C1− cells .

Therapeutic Targeting

  • Peptide-Specific CTLs: HLA-A24-restricted OR7C1 peptides induced cytotoxic T lymphocytes (CTLs) that lysed OSCC CSCs in vitro (80% cytotoxicity at effector:target = 40:1) .

  • In Vivo Efficacy: Adoptive transfer of OR7C1-specific CTLs reduced tumor growth in CRC mouse models .

Immunotherapy Applications

  • Vaccine Development: OR7C1-derived peptides (e.g., OR7C1_93) are candidates for CSC-targeted vaccines .

  • Companion Diagnostic: OR7C1 antibody identifies patients eligible for OR7C1-directed therapies .

Limitations and Future Directions

  • Tissue Specificity: While absent in most normal tissues, off-target effects in testes require evaluation .

  • Clinical Trials: No Phase III trials yet; preclinical data warrant validation in larger cohorts .

Product Specs

Buffer
The antibody is provided as a liquid solution in phosphate-buffered saline (PBS) containing 50% glycerol, 0.5% bovine serum albumin (BSA), and 0.02% sodium azide.
Form
Liquid
Lead Time
Typically, we are able to ship orders within 1-3 business days of receipt. Delivery times may vary depending on the shipping method and destination. For specific delivery estimates, please contact your local distributor.
Synonyms
OR7C1; OR7C4; Olfactory receptor 7C1; Olfactory receptor 7C4; Olfactory receptor OR19-16; Olfactory receptor TPCR86
Target Names
OR7C1
Uniprot No.

Target Background

Function
This antibody targets the odorant receptor protein.
Database Links

HGNC: 8373

KEGG: hsa:26664

STRING: 9606.ENSP00000248073

UniGene: Hs.466053

Protein Families
G-protein coupled receptor 1 family
Subcellular Location
Cell membrane; Multi-pass membrane protein.

Q&A

What is OR7C1 and why is it significant in cancer research?

OR7C1 is a seven transmembrane G-protein-coupled olfactory receptor that is expressed in non-olfactory tissues, particularly in cancer stem cells. Its significance lies in its selective expression in cancer stem cells but limited expression in normal tissues (primarily restricted to testis), making it a promising cancer/testis antigen and potential target for cancer immunotherapy . In oral cancers, OR7C1 expression is predominantly limited to cancer stem cells, suggesting its utility as a biomarker for this therapy-resistant subpopulation . Similarly, in colorectal cancer, OR7C1 has been identified as a functional marker for cancer-initiating cells with higher tumorigenicity .

What are the common applications of OR7C1 antibodies in cancer stem cell research?

OR7C1 antibodies are primarily used in several key applications:

  • Immunohistochemical staining of formalin-fixed, paraffin-embedded cancer tissues to evaluate OR7C1 expression levels and correlate with patient prognosis

  • Identification and isolation of cancer stem cell populations through flow cytometry

  • Validation of OR7C1 knockdown experiments using siRNA transfection

  • Western blot analysis for protein expression in cancer cell lines

  • Evaluation of OR7C1 as a target for cytotoxic T lymphocyte (CTL)-mediated immunotherapy

What antibody specifications are most important for OR7C1 detection in research applications?

When selecting an OR7C1 antibody for research, several specifications are critical:

  • Host species and clonality: Rabbit polyclonal antibodies are commonly used for OR7C1 detection, such as the HPA047127 antibody from Sigma-Aldrich

  • Specificity: Antibodies specific for human OR7C1 (also known as OR7C4, OR19-16, or TPCR86) with minimal cross-reactivity

  • Validated applications: Confirm the antibody is validated for your specific application (IHC, Western blot, ELISA, etc.)

  • Working dilution: For immunohistochemistry, dilutions between 1:1000-1:2500 are typically recommended

  • Immunogen information: Knowledge of the specific peptide sequence used as the immunogen (e.g., "ETGNQTHAQEFLLLGFSATSEIQF" for certain commercial antibodies)

How should immunohistochemistry protocols be optimized for OR7C1 detection in cancer tissues?

For optimal OR7C1 detection in cancer tissues via immunohistochemistry:

  • Tissue preparation: Use formalin-fixed, paraffin-embedded sections cut to approximately 4-μm thickness

  • Antigen retrieval: Perform heat-induced epitope retrieval prior to antibody incubation

  • Blocking: Block with normal serum for approximately 60 minutes to reduce background staining

  • Primary antibody: Incubate with rabbit anti-OR7C1 polyclonal antibody (HPA047127, Sigma-Aldrich) at a 1:100 dilution for oral cancer tissues or at 1:1000-1:2500 for other applications

  • Secondary antibody: Use an appropriate HRP-conjugated secondary antibody

  • Visualization: Develop using a DAB (diaminobenzidine) kit and counterstain with hematoxylin

  • Evaluation criteria: For oral SCC, cases can be stratified into high, moderate, and low OR7C1 expression groups using cutoffs of 50% and 5% positive rates

What methods are effective for isolating OR7C1-positive cancer stem cells from heterogeneous tumor populations?

Effective isolation of OR7C1-positive cancer stem cells involves:

  • Primary isolation using established cancer stem cell markers: For oral cancer, CD44 microbeads can be used for initial enrichment of the stem cell population, as CD44+ cells show higher OR7C1 expression

  • Flow cytometry: OR7C1-positive cells can be isolated using fluorescently-labeled antibodies against OR7C1, with appropriate gating strategies based on isotype controls

  • Side population (SP) analysis: For colorectal cancer, initial isolation of cancer stem cells as side population cells, followed by characterization of OR7C1 expression

  • Verification of stemness: Confirm cancer stem cell properties through RT-qPCR analysis of stemness markers (SOX2, Nanog, Oct-4/POU5F1) in the isolated OR7C1-positive population

  • Functional validation: Perform sphere formation assays to verify the self-renewal capacity of the isolated cells

How can OR7C1 gene expression be accurately quantified in cancer stem cell populations?

For accurate quantification of OR7C1 gene expression:

  • RNA isolation: Extract total RNA using TRIzol reagent or specialized kits (e.g., Qiagen Mini Kit or All-Prep DNA/RNA Mini Kit) from sorted cancer stem cell populations

  • cDNA synthesis: Perform reverse transcription with Superscript III and oligo(dT) primers

  • RT-qPCR setup: Use SYBR Green Master Mix with specific primers for OR7C1 and housekeeping genes like GAPDH

  • PCR conditions: Initial denaturation at 95°C for 10 min, followed by 50 cycles of denaturation (95°C for 15s) and annealing/extension (60°C for 60s)

  • Data analysis: Calculate relative expression using the ΔΔCt method, normalizing to GAPDH expression

  • Controls: Include positive controls (known OR7C1-expressing tissues like testis) and negative controls

What mechanisms underlie OR7C1's role in maintaining cancer stem cell properties, and how can they be experimentally validated?

OR7C1's role in cancer stem cell maintenance can be investigated through:

  • Gene knockdown experiments: Use OR7C1-specific siRNAs to transfect cancer cells and evaluate the impact on stemness properties

    • Transfection method: Lipofectamine RNAiMAX reagent in Opti-MEM

    • Incubation time: 48 hours post-transfection

    • Readouts: Sphere formation assays, expression of stemness markers (SOX2, Nanog, Oct-4)

  • Cell cycle analysis: Evaluate the effect of OR7C1 knockdown on cell cycle progression using DNA content stains (e.g., Cell Cycle Assay Solution Blue) followed by flow cytometry analysis

  • Tumorigenic potential assessment: Compare the tumorigenicity of OR7C1-positive versus OR7C1-negative populations through limiting dilution assays in immunodeficient mice

  • Pathway analysis: Investigate potential downstream signaling pathways through which OR7C1 may maintain stemness properties, using phospho-specific antibodies against candidate pathways in Western blots after OR7C1 manipulation

  • Correlation with patient outcomes: Analyze the relationship between OR7C1 expression levels in tumors and patient prognosis through survival analysis

How do the functional roles of OR7C1 differ between oral squamous cell carcinoma and colorectal cancer stem cells?

To investigate the differential roles of OR7C1 across cancer types:

  • Comparative expression analysis: Quantify OR7C1 expression levels in CSCs from both cancer types using standardized RT-qPCR and Western blot protocols

  • Co-expression network analysis: Identify cancer-specific co-expressed genes through RNA-seq or microarray analysis of OR7C1-positive populations from each cancer type

  • Functional impact of knockdown: Compare the effects of OR7C1 siRNA on sphere formation, invasion, migration, and drug resistance in both cancer types

  • Ligand interaction studies: Investigate whether OR7C1 responds to different ligands or activates different downstream pathways in oral versus colorectal cancer cells

  • Clinical correlation: Analyze tissue microarrays from both cancer types to determine if OR7C1 expression correlates with different clinicopathological features

What are the optimal parameters for developing OR7C1-specific cytotoxic T lymphocyte (CTL) clones for cancer immunotherapy?

For developing effective OR7C1-specific CTL clones:

  • Peptide identification: Identify HLA-restricted OR7C1 peptides with high binding affinity to common HLA alleles (e.g., HLA-A24)

  • CTL generation: Isolate CD8+ T cells from healthy donors and stimulate with identified OR7C1 peptides in the presence of appropriate antigen-presenting cells

  • Specificity validation: Confirm CTL specificity using ELISPOT assays with the following parameters:

    • Target cells: T2-A24 cells loaded with OR7C1 peptides or cancer cell lines expressing OR7C1

    • Effector:target ratios: 5:1 or 1:1

    • Incubation time: 24 hours at 37°C in 5% CO2

    • Detection: Biotinylated anti-human IFNγ antibody followed by streptavidin-HRP and AEC substrate

  • Cytotoxicity assessment: Evaluate the selective killing of OR7C1-expressing cancer stem cells versus bulk tumor cells using cytotoxicity assays

  • In vivo efficacy: Test the anti-tumor activity of OR7C1-specific CTL clones in adoptive transfer models using immunodeficient mice bearing human tumor xenografts

How can non-specific staining be minimized when using OR7C1 antibodies for immunohistochemistry?

To minimize non-specific staining:

  • Antibody titration: Systematically test dilutions between 1:100 and 1:2500 to determine the optimal concentration that maximizes specific signal while minimizing background

  • Enhanced blocking: Use a combination of serum blocking (60 minutes) and protein-based blockers to reduce non-specific binding

  • Control tissues: Always include positive controls (testis tissue, known OR7C1-expressing tumors) and negative controls (omission of primary antibody, tissues known to be OR7C1-negative)

  • Antibody validation: Confirm antibody specificity using tissues from OR7C1 knockdown experiments or competitive blocking with the immunizing peptide

  • Counterstain optimization: Adjust hematoxylin counterstaining time to ensure nuclear details are visible without obscuring OR7C1 staining

  • Antigen retrieval method comparison: Compare heat-induced epitope retrieval methods (citrate buffer, EDTA buffer) to determine which provides optimal signal-to-noise ratio for OR7C1 detection

What strategies can address variability in OR7C1 detection across different patient samples?

To address inter-sample variability:

  • Standardized sample processing: Ensure consistent fixation times (24-48 hours in 10% neutral buffered formalin) and paraffin embedding protocols across all samples

  • Batch processing: Process all comparative samples in the same experimental batch to minimize technical variation

  • Quantitative scoring system: Implement a robust scoring system that accounts for both staining intensity (0-3 scale) and percentage of positive cells

  • Internal normalization: Include reference markers that should be consistently expressed to verify staining quality across samples

  • Digital image analysis: Utilize quantitative image analysis software to obtain objective measurements of OR7C1 staining intensity and distribution

  • Statistical approaches: Apply appropriate statistical methods to account for biological variation when comparing OR7C1 expression across patient cohorts

How might single-cell analysis technologies enhance our understanding of OR7C1 expression heterogeneity in cancer stem cells?

Single-cell technologies can advance OR7C1 research through:

  • Single-cell RNA sequencing (scRNA-seq): Apply scRNA-seq to analyze the heterogeneity of OR7C1 expression within cancer stem cell populations and identify co-expression patterns with other stemness markers

  • Single-cell protein analysis: Use mass cytometry (CyTOF) or single-cell Western blotting to simultaneously analyze OR7C1 protein expression alongside other cancer stem cell markers at the single-cell level

  • Spatial transcriptomics: Map the spatial distribution of OR7C1-expressing cells within tumor tissues to understand their relationship with the tumor microenvironment

  • Lineage tracing: Perform in vivo lineage tracing of OR7C1-expressing cells to determine their contribution to tumor growth and metastasis

  • Drug response profiling: Combine single-cell analysis with drug treatment to identify differential responses of OR7C1-positive versus OR7C1-negative cells to conventional therapies and targeted agents

What potential exists for developing OR7C1-targeted therapeutic approaches beyond CTL-based immunotherapy?

Additional therapeutic strategies targeting OR7C1 could include:

  • Antibody-drug conjugates (ADCs): Develop ADCs using anti-OR7C1 antibodies conjugated to cytotoxic payloads for selective delivery to OR7C1-expressing cancer stem cells

  • Bispecific T-cell engagers (BiTEs): Design BiTEs that simultaneously bind OR7C1 on cancer cells and CD3 on T cells to facilitate immune-mediated killing of OR7C1-positive cells

  • CAR-T cell therapy: Generate chimeric antigen receptor T cells targeting OR7C1 for adoptive cell therapy approaches

  • Small molecule inhibitors: Develop small molecules that can disrupt OR7C1 signaling or functions critical for cancer stem cell maintenance

  • Combination approaches: Investigate synergistic combinations of OR7C1-targeted therapies with conventional treatments to overcome therapeutic resistance

Quick Inquiry

Personal Email Detected
Please use an institutional or corporate email address for inquiries. Personal email accounts ( such as Gmail, Yahoo, and Outlook) are not accepted. *
© Copyright 2025 TheBiotek. All Rights Reserved.