OR7C1 antibody detects the OR7C1 protein, a seven-transmembrane olfactory receptor expressed in non-olfactory tissues such as testes and cancers. OR7C1 is a cancer/testis antigen selectively expressed in CSCs of oral squamous cell carcinoma (OSCC) and colorectal cancer (CRC) . CSCs drive tumor recurrence, metastasis, and therapy resistance due to their self-renewal and drug-efflux capabilities .
IHC Staining: OR7C1 expression was assessed in 13 OSCC biopsies, revealing high expression in 61.5% of cases .
siRNA Knockdown: OR7C1-specific siRNAs reduced stemness markers (SOX2, Nanog, POU5F1) and inhibited sphere formation in HSC-2 cells .
RT-qPCR Primers: Validated primers for OR7C1 and stemness markers (Table 1) .
| Gene | Forward Primer (5’→3’) | Reverse Primer (5’→3’) |
|---|---|---|
| OR7C1 | AGCTCTGTGGACTGCTGGTT | GGACGCCAGTTGCAAAGTAT |
| SOX2 | GCTACAGCATGATGCAGGACCA | TCTGCGAGCTGGTCATGGAGTT |
| Nanog | GCTGAGATGCCTCACACGGAG | TCTGTTTCTTGACCGGGACCTTGTC |
| POU5F1 | TGGAGAAGGAGAAGCTGGAGCAAAA | GGCAGATGGTCGTTTGGCTGAATA |
TCGA/GTEx Data: OR7C1 mRNA levels (FPKM-UQ) were elevated in 57.5% of OSCCs and CRCs compared to normal tissues (testes: mean = 6.199; OSCC: mean = 7.8) .
Selectivity: Expressed in CSCs (CD44+/CD133+ populations) but absent in non-CSCs and most normal tissues .
| Tissue Type | Mean FPKM-UQ (OR7C1) | Clinical Relevance |
|---|---|---|
| Testes (Normal) | 6.199 | Baseline expression |
| Oral SCC | 7.8 | 57.5% of cases >8 FPKM-UQ |
| Colon Cancer | 7.5 | Poor prognosis marker |
Stemness Maintenance: OR7C1 knockdown reduced SOX2, Nanog, and POU5F1 expression by 60–80% and decreased sphere-forming capacity .
Tumorigenicity: OR7C1+ colon CICs showed 3× higher tumorigenicity in xenograft models than OR7C1− cells .
Peptide-Specific CTLs: HLA-A24-restricted OR7C1 peptides induced cytotoxic T lymphocytes (CTLs) that lysed OSCC CSCs in vitro (80% cytotoxicity at effector:target = 40:1) .
In Vivo Efficacy: Adoptive transfer of OR7C1-specific CTLs reduced tumor growth in CRC mouse models .
Vaccine Development: OR7C1-derived peptides (e.g., OR7C1_93) are candidates for CSC-targeted vaccines .
Companion Diagnostic: OR7C1 antibody identifies patients eligible for OR7C1-directed therapies .
OR7C1 is a seven transmembrane G-protein-coupled olfactory receptor that is expressed in non-olfactory tissues, particularly in cancer stem cells. Its significance lies in its selective expression in cancer stem cells but limited expression in normal tissues (primarily restricted to testis), making it a promising cancer/testis antigen and potential target for cancer immunotherapy . In oral cancers, OR7C1 expression is predominantly limited to cancer stem cells, suggesting its utility as a biomarker for this therapy-resistant subpopulation . Similarly, in colorectal cancer, OR7C1 has been identified as a functional marker for cancer-initiating cells with higher tumorigenicity .
OR7C1 antibodies are primarily used in several key applications:
Immunohistochemical staining of formalin-fixed, paraffin-embedded cancer tissues to evaluate OR7C1 expression levels and correlate with patient prognosis
Identification and isolation of cancer stem cell populations through flow cytometry
Validation of OR7C1 knockdown experiments using siRNA transfection
Western blot analysis for protein expression in cancer cell lines
Evaluation of OR7C1 as a target for cytotoxic T lymphocyte (CTL)-mediated immunotherapy
When selecting an OR7C1 antibody for research, several specifications are critical:
Host species and clonality: Rabbit polyclonal antibodies are commonly used for OR7C1 detection, such as the HPA047127 antibody from Sigma-Aldrich
Specificity: Antibodies specific for human OR7C1 (also known as OR7C4, OR19-16, or TPCR86) with minimal cross-reactivity
Validated applications: Confirm the antibody is validated for your specific application (IHC, Western blot, ELISA, etc.)
Working dilution: For immunohistochemistry, dilutions between 1:1000-1:2500 are typically recommended
Immunogen information: Knowledge of the specific peptide sequence used as the immunogen (e.g., "ETGNQTHAQEFLLLGFSATSEIQF" for certain commercial antibodies)
For optimal OR7C1 detection in cancer tissues via immunohistochemistry:
Tissue preparation: Use formalin-fixed, paraffin-embedded sections cut to approximately 4-μm thickness
Antigen retrieval: Perform heat-induced epitope retrieval prior to antibody incubation
Blocking: Block with normal serum for approximately 60 minutes to reduce background staining
Primary antibody: Incubate with rabbit anti-OR7C1 polyclonal antibody (HPA047127, Sigma-Aldrich) at a 1:100 dilution for oral cancer tissues or at 1:1000-1:2500 for other applications
Secondary antibody: Use an appropriate HRP-conjugated secondary antibody
Visualization: Develop using a DAB (diaminobenzidine) kit and counterstain with hematoxylin
Evaluation criteria: For oral SCC, cases can be stratified into high, moderate, and low OR7C1 expression groups using cutoffs of 50% and 5% positive rates
Effective isolation of OR7C1-positive cancer stem cells involves:
Primary isolation using established cancer stem cell markers: For oral cancer, CD44 microbeads can be used for initial enrichment of the stem cell population, as CD44+ cells show higher OR7C1 expression
Flow cytometry: OR7C1-positive cells can be isolated using fluorescently-labeled antibodies against OR7C1, with appropriate gating strategies based on isotype controls
Side population (SP) analysis: For colorectal cancer, initial isolation of cancer stem cells as side population cells, followed by characterization of OR7C1 expression
Verification of stemness: Confirm cancer stem cell properties through RT-qPCR analysis of stemness markers (SOX2, Nanog, Oct-4/POU5F1) in the isolated OR7C1-positive population
Functional validation: Perform sphere formation assays to verify the self-renewal capacity of the isolated cells
For accurate quantification of OR7C1 gene expression:
RNA isolation: Extract total RNA using TRIzol reagent or specialized kits (e.g., Qiagen Mini Kit or All-Prep DNA/RNA Mini Kit) from sorted cancer stem cell populations
cDNA synthesis: Perform reverse transcription with Superscript III and oligo(dT) primers
RT-qPCR setup: Use SYBR Green Master Mix with specific primers for OR7C1 and housekeeping genes like GAPDH
PCR conditions: Initial denaturation at 95°C for 10 min, followed by 50 cycles of denaturation (95°C for 15s) and annealing/extension (60°C for 60s)
Data analysis: Calculate relative expression using the ΔΔCt method, normalizing to GAPDH expression
Controls: Include positive controls (known OR7C1-expressing tissues like testis) and negative controls
OR7C1's role in cancer stem cell maintenance can be investigated through:
Gene knockdown experiments: Use OR7C1-specific siRNAs to transfect cancer cells and evaluate the impact on stemness properties
Transfection method: Lipofectamine RNAiMAX reagent in Opti-MEM
Incubation time: 48 hours post-transfection
Readouts: Sphere formation assays, expression of stemness markers (SOX2, Nanog, Oct-4)
Cell cycle analysis: Evaluate the effect of OR7C1 knockdown on cell cycle progression using DNA content stains (e.g., Cell Cycle Assay Solution Blue) followed by flow cytometry analysis
Tumorigenic potential assessment: Compare the tumorigenicity of OR7C1-positive versus OR7C1-negative populations through limiting dilution assays in immunodeficient mice
Pathway analysis: Investigate potential downstream signaling pathways through which OR7C1 may maintain stemness properties, using phospho-specific antibodies against candidate pathways in Western blots after OR7C1 manipulation
Correlation with patient outcomes: Analyze the relationship between OR7C1 expression levels in tumors and patient prognosis through survival analysis
To investigate the differential roles of OR7C1 across cancer types:
Comparative expression analysis: Quantify OR7C1 expression levels in CSCs from both cancer types using standardized RT-qPCR and Western blot protocols
Co-expression network analysis: Identify cancer-specific co-expressed genes through RNA-seq or microarray analysis of OR7C1-positive populations from each cancer type
Functional impact of knockdown: Compare the effects of OR7C1 siRNA on sphere formation, invasion, migration, and drug resistance in both cancer types
Ligand interaction studies: Investigate whether OR7C1 responds to different ligands or activates different downstream pathways in oral versus colorectal cancer cells
Clinical correlation: Analyze tissue microarrays from both cancer types to determine if OR7C1 expression correlates with different clinicopathological features
For developing effective OR7C1-specific CTL clones:
Peptide identification: Identify HLA-restricted OR7C1 peptides with high binding affinity to common HLA alleles (e.g., HLA-A24)
CTL generation: Isolate CD8+ T cells from healthy donors and stimulate with identified OR7C1 peptides in the presence of appropriate antigen-presenting cells
Specificity validation: Confirm CTL specificity using ELISPOT assays with the following parameters:
Cytotoxicity assessment: Evaluate the selective killing of OR7C1-expressing cancer stem cells versus bulk tumor cells using cytotoxicity assays
In vivo efficacy: Test the anti-tumor activity of OR7C1-specific CTL clones in adoptive transfer models using immunodeficient mice bearing human tumor xenografts
To minimize non-specific staining:
Antibody titration: Systematically test dilutions between 1:100 and 1:2500 to determine the optimal concentration that maximizes specific signal while minimizing background
Enhanced blocking: Use a combination of serum blocking (60 minutes) and protein-based blockers to reduce non-specific binding
Control tissues: Always include positive controls (testis tissue, known OR7C1-expressing tumors) and negative controls (omission of primary antibody, tissues known to be OR7C1-negative)
Antibody validation: Confirm antibody specificity using tissues from OR7C1 knockdown experiments or competitive blocking with the immunizing peptide
Counterstain optimization: Adjust hematoxylin counterstaining time to ensure nuclear details are visible without obscuring OR7C1 staining
Antigen retrieval method comparison: Compare heat-induced epitope retrieval methods (citrate buffer, EDTA buffer) to determine which provides optimal signal-to-noise ratio for OR7C1 detection
To address inter-sample variability:
Standardized sample processing: Ensure consistent fixation times (24-48 hours in 10% neutral buffered formalin) and paraffin embedding protocols across all samples
Batch processing: Process all comparative samples in the same experimental batch to minimize technical variation
Quantitative scoring system: Implement a robust scoring system that accounts for both staining intensity (0-3 scale) and percentage of positive cells
Internal normalization: Include reference markers that should be consistently expressed to verify staining quality across samples
Digital image analysis: Utilize quantitative image analysis software to obtain objective measurements of OR7C1 staining intensity and distribution
Statistical approaches: Apply appropriate statistical methods to account for biological variation when comparing OR7C1 expression across patient cohorts
Single-cell technologies can advance OR7C1 research through:
Single-cell RNA sequencing (scRNA-seq): Apply scRNA-seq to analyze the heterogeneity of OR7C1 expression within cancer stem cell populations and identify co-expression patterns with other stemness markers
Single-cell protein analysis: Use mass cytometry (CyTOF) or single-cell Western blotting to simultaneously analyze OR7C1 protein expression alongside other cancer stem cell markers at the single-cell level
Spatial transcriptomics: Map the spatial distribution of OR7C1-expressing cells within tumor tissues to understand their relationship with the tumor microenvironment
Lineage tracing: Perform in vivo lineage tracing of OR7C1-expressing cells to determine their contribution to tumor growth and metastasis
Drug response profiling: Combine single-cell analysis with drug treatment to identify differential responses of OR7C1-positive versus OR7C1-negative cells to conventional therapies and targeted agents
Additional therapeutic strategies targeting OR7C1 could include:
Antibody-drug conjugates (ADCs): Develop ADCs using anti-OR7C1 antibodies conjugated to cytotoxic payloads for selective delivery to OR7C1-expressing cancer stem cells
Bispecific T-cell engagers (BiTEs): Design BiTEs that simultaneously bind OR7C1 on cancer cells and CD3 on T cells to facilitate immune-mediated killing of OR7C1-positive cells
CAR-T cell therapy: Generate chimeric antigen receptor T cells targeting OR7C1 for adoptive cell therapy approaches
Small molecule inhibitors: Develop small molecules that can disrupt OR7C1 signaling or functions critical for cancer stem cell maintenance
Combination approaches: Investigate synergistic combinations of OR7C1-targeted therapies with conventional treatments to overcome therapeutic resistance