OSBPL2 Antibody

What is OSBPL2 and what are its primary research applications?

OSBPL2 (oxysterol binding protein-like 2, also known as ORP2) is a member of the oxysterol-binding protein family involved in lipid transport and signaling. Current research focuses on:

• Hearing loss mechanisms, particularly DFNA67 autosomal dominant hearing loss

• Inner and outer hair cell stereocilia development

• Ciliogenesis and Sonic hedgehog (Shh) signaling

• Lipid metabolism and transport

OSBPL2 has a calculated molecular weight of 55 kDa, though observed weights of 51 kDa and 56 kDa have been reported in Western blot applications . The protein contains two main domains: the FFAT (two phenylalanines in an acidic tract) motif, which targets the endoplasmic reticulum, and the ORD (OSBP-related domain), essential for binding and transferring sterols, oxysterols, and phosphoinositides .

For optimal Western blot detection of OSBPL2:

• Sample preparation:

  • Prepare cell/tissue lysates in RIPA buffer with protease inhibitors

  • For detection of aggregates in mutant OSBPL2, consider denaturing conditions

• Gel electrophoresis:

  • Load 20-30 μg of total protein per lane

  • Run on 10-12% SDS-PAGE gel

• Transfer and blocking:

  • Transfer to PVDF membrane

  • Block with 5% non-fat milk in TBST for 1 hour at room temperature

• Antibody incubation:

  • Primary antibody: Dilute OSBPL2 antibody 1:1000-1:8000 in blocking buffer

  • Incubate overnight at 4°C

  • Secondary antibody: Use appropriate HRP-conjugated secondary antibody at 1:5000-1:10000

• Detection:

  • Develop using ECL substrate

  • Expected molecular weights: 51 kDa and 56 kDa bands

  • For mutant OSBPL2 detection, look for multimer bands of higher molecular weight

• Controls:

  • Positive controls: HeLa, A549, HuH-7, HepG2 cells or mouse brain tissue

  • Negative controls: OSBPL2 knockout cell lines generated by CRISPR/Cas9

What dilutions should I use for different applications of OSBPL2 antibodies?

Recommended dilutions vary by application and specific antibody. For antibody 14751-1-AP:

For other antibodies:

• DyLight 650-conjugated antibody (NBP2-97886C): Optimal dilution should be experimentally determined for IHC-P

• DF12681: Recommended for WB and IF/ICC applications in human and mouse samples

• C-terminal antibody (ABIN185116): Effective in ELISA (detection limit dilution 1:8000)

Always perform a dilution series to optimize for your specific experimental conditions and sample types.

How can I validate OSBPL2 antibody specificity in knockout models?

Validating antibody specificity using knockout models is crucial for ensuring reliable results:

• Generate OSBPL2 knockout models:

  • CRISPR/Cas9 system targeting exon 3 or 4 of OSBPL2

  • Example guide RNA sequence for targeting exon 4: CAGCGGCTGGGACTGACTTG

  • Verify knockout by genomic DNA sequencing to confirm indels

• Validation strategy:

  • Western blot: Compare wild-type vs. knockout samples

  • Look for absence of bands at 51-56 kDa in knockout samples

  • Include loading controls (β-actin, GAPDH)

  • Test across multiple cell lines when possible (HEK293, HEI-OC1, HeLa)

• Additional controls:

  • Use rescue experiments by reintroducing wild-type OSBPL2 to knockout cells

  • Compare with cells expressing truncated OSBPL2 constructs lacking specific domains (ΔFFAT, ΔORD)

• Quantitative validation:

  • Perform RT-qPCR to confirm knockout at mRNA level

  • Example primers: mouse Osbpl2 (Mm01210488_m1) with Hprt1 (Mm01318747_g1) as control

  • Compare protein and mRNA levels to verify concordance

For researchers studying OSBPL2 in hearing loss models, consider validating with both homozygous and heterozygous knockout mice, as phenotypes may differ between genotypes .

What are the considerations when detecting both wild-type and mutant OSBPL2 proteins?

Detecting wild-type and mutant OSBPL2 proteins in the same sample presents unique challenges:

• Understanding mutant properties:

  • Frameshift mutations (e.g., p.R50Afs103, p.Q53Rfs100, p.H60Qfs*93) create truncated proteins that form cytoplasmic aggregates

  • Missense mutations (e.g., p.L195M) may show localization patterns similar to wild-type

• Subcellular localization analysis:

  • Use immunofluorescence to compare distribution patterns

  • Wild-type OSBPL2: Diffusely distributed throughout cytoplasm

  • Truncated mutants: Form distinct cytoplasmic aggregates

  • Protocol:

    • Fix cells in 4% paraformaldehyde (10 min, RT)

    • Permeabilize with 0.1% Triton X-100 (3 min, RT)

    • Block with 1% BSA in PBS

    • Incubate with primary antibody overnight at 4°C

    • Detect with appropriate fluorophore-conjugated secondary antibodies

• Western blot considerations:

  • Truncated mutants form multimers visible as higher molecular weight bands

  • Use denaturing conditions to resolve aggregates

  • Observe band patterns with/without lysosomal inhibitors (bafilomycin A1, chloroquine)

  • Proteasome inhibitors (MG132) show limited effect on mutant OSBPL2 degradation

• Protein stability assessment:

  • Perform cycloheximide chase experiments (100 μg/ml) for up to 12 hours

  • Mutant OSBPL2 (especially multimers) shows greater stability than wild-type

• Co-immunoprecipitation:

  • Determine if mutants interact with wild-type protein (potential dominant-negative effect)

  • Example: p.Q53Rfs*100 mutant can form dimers with wild-type OSBPL2

How can I optimize immunofluorescence protocols for OSBPL2 in cochlear tissue?

Cochlear tissue presents unique challenges for immunofluorescence due to its complex structure:

• Tissue preparation:

  • Fix cochleae in 2% paraformaldehyde (2 hours, RT)

  • Decalcify in 10% EDTA (24-48 hours, 4°C) for adult cochlea

  • Cryoprotect in 30% sucrose solution

  • Embed in OCT and prepare 10 μm cryosections on SuperFrost Plus slides

  • Store at -20°C until use

• Staining protocol optimization:

  • Thaw and permeabilize sections with 0.1% Triton X-100 (3 min, RT)

  • Block with 1% BSA in PBS

  • For OSBPL2 detection, recommended antibody dilution: 1:50 (goat anti-ORP-2)

  • For co-localization studies, combine with markers such as:

    • Anti-prestin (1:5000) for outer hair cells

    • Anti-otoferlin (1:10000) for inner hair cells

  • Incubate overnight at 4°C

  • Detect with appropriate secondary antibodies (Cy3 or Alexa488-conjugated)

  • Mount with Vectashield containing DAPI

• Imaging considerations:

  • Use z-stack imaging (approximately 30 × 0.27 μm, ~8 μm total)

  • Apply 3D deconvolution using advanced maximum likelihood estimation algorithm

  • Process with appropriate software (e.g., cellSens Dimension)

• Controls and validation:

  • Include OSBPL2 knockout tissue as negative control

  • Use double-staining with known hair cell markers to confirm localization

  • Compare wild-type and mutant expression patterns in cochlear sections

What methodological considerations are important for co-immunoprecipitation with OSBPL2 antibodies?

Co-immunoprecipitation (Co-IP) is valuable for studying OSBPL2 protein interactions:

• Experimental design:

  • For exogenous expression: Use tagged constructs (FLAG-OSBPL2) in HEK293T cells

  • For endogenous interactions: Use specific OSBPL2 antibodies with appropriate cell/tissue lysates

• Protocol optimization:

  • Lysis buffer: 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP-40, with protease inhibitors

  • For membrane-associated interactions, consider adding 0.5% sodium deoxycholate

  • Clear lysates by centrifugation (14,000 × g, 10 min, 4°C)

  • Pre-clear with protein A/G beads to reduce non-specific binding

• Antibody selection:

  • For IP of endogenous OSBPL2: use 4 μg of antibody per 1-3 mg of lysate

  • For FLAG-tagged OSBPL2: use anti-FLAG M2 affinity gel (Sigma-Aldrich)

  • Incubate overnight at 4°C with gentle rotation

• Washing and elution:

  • Wash beads at least 5 times with lysis buffer

  • Elute in 6× SDS loading buffer by boiling (100°C, 10 min)

  • Analyze by Western blotting with appropriate antibodies

• Controls and validation:

  • Use normal IgG as negative control

  • Include input sample (5-10% of lysate used for IP)

  • For wild-type vs. mutant comparisons, analyze complex formation patterns

• Advanced applications:

  • For proteomics identification of interacting partners, perform LC-MS/MS analysis of immunoprecipitated complexes

  • Consider crosslinking approaches for transient interactions

How should I approach troubleshooting inconsistent OSBPL2 detection between tissues and cell lines?

Inconsistent OSBPL2 detection across different biological samples can be addressed systematically:

• Expression level variations:

  • OSBPL2 is widely expressed but at varying levels across tissues

  • Consider loading higher protein amounts (30-50 μg) for tissues with low expression

  • Use positive controls: HeLa, A549, HuH-7, HepG2 cells or mouse brain tissue

• Antibody selection considerations:

  • Different antibodies target distinct epitopes (N-terminal vs. C-terminal)

  • For truncated mutants, ensure antibody recognizes available epitopes

  • Consider isoform specificity (e.g., NP_055650.1 vs. NP_653081.1)

• Sample preparation optimization:

  • For membrane-associated OSBPL2, include mild detergents (0.5% NP-40)

  • For aggregation-prone mutants, adjust lysis conditions appropriately

  • Sample storage: Avoid multiple freeze-thaw cycles

• Protocol adjustments:

  • Western blot: Try different transfer conditions (wet vs. semi-dry)

  • IHC/IF: Compare antigen retrieval methods (TE buffer pH 9.0 vs. citrate buffer pH 6.0)

  • Adjust blocking conditions to reduce background

• Systematic optimization approach:

  • Test multiple antibody dilutions (1:500, 1:1000, 1:2000, 1:4000, 1:8000)

  • Compare different detection systems (ECL vs. fluorescent)

  • Optimize incubation times and temperatures

• Validation strategies:

  • Confirm specificity using siRNA knockdown or CRISPR/Cas9 knockout

  • Verify transcript levels by RT-PCR or RT-qPCR

  • Consider exogenous expression of tagged OSBPL2 as positive control

What experimental controls should be used when studying OSBPL2 mutations in hearing loss models?

Research on OSBPL2 mutations in hearing loss requires rigorous controls:

• Genetic model controls:

  • Include age-matched wild-type (+/+), heterozygous (+/-), and homozygous (-/-) knockout animals

  • Generate animals with specific human mutations using CRISPR/Cas9

  • Example target: Exon 3 of mouse Osbpl2 to recapitulate human frameshift mutations

• Phenotypic assessments:

  • Perform auditory brainstem response (ABR) testing at multiple frequencies

  • Compare ABR thresholds across genotypes and age groups

  • Assess distortion product otoacoustic emissions (DPOAEs)

• Molecular analysis controls:

  • Verify genotype by PCR and sequencing

  • Confirm protein expression by Western blot

  • Include T7E1 assay for CRISPR editing validation

• Histological examinations:

  • Compare cochlear morphology between genotypes

  • Use double immunofluorescence with markers for:

    • Hair cells (prestin, otoferlin)

    • Stereocilia (phalloidin)

    • Primary cilia markers if studying ciliogenesis

• Functional studies:

  • For lipid metabolism studies, include serum lipid profile analysis

  • For ciliary function, analyze Shh pathway activation using GLI3 localization

  • For autophagy studies, monitor LC3 conversion with/without inhibitors

• Rescue experiments:

  • Reintroduce wild-type OSBPL2 in knockout models

  • Compare with domain-specific mutants (ΔFFAT, ΔORD) to identify critical functional regions

  • Assess hearing function after rescue attempts

How does OSBPL2 function in ciliogenesis, and what methods are best to study this relationship?

Recent research has established OSBPL2's role in ciliogenesis:

• Experimental approaches:

  • Generate OSBPL2-deficient cells using CRISPR/Cas9

  • Compare ciliary length and structure in wild-type vs. knockout cells

  • Analyze phosphoinositide distribution on ciliary membranes

• Key experimental findings:

  • OSBPL2 regulates primary cilia length through its ORD domain

  • Reintroduction of wild-type OSBPL2 or ΔFFAT mutant restores cilia length in knockout cells

  • ΔORD mutant fails to rescue cilia length defects

• Phosphoinositide analysis:

  • PI(4,5)P₂ levels on ciliary membranes are regulated by OSBPL2

  • Methods to study PI distribution include specialized immunofluorescence techniques

• Sonic hedgehog (Shh) signaling assessment:

  • OSBPL2 deficiency impairs SMO accumulation in cilia after pathway activation

  • GLI3 accumulation at ciliary tips is reduced in OSBPL2 knockout cells

  • Treatment with Shh pathway agonist (SAG) can be used to test pathway functionality

• Recommended protocols:

  • Serum-starve cells (24h) to induce cilia formation

  • Immunostain for acetylated α-tubulin to visualize cilia

  • Measure cilia length and quantify percentage of ciliated cells

  • Analyze ciliary localization of Shh pathway components after SAG treatment

What methods should be used to investigate OSBPL2's role in autophagy and protein aggregation?

OSBPL2 mutations can lead to protein aggregation and autophagy defects:

• Protein aggregation analysis:

  • Compare wild-type and mutant OSBPL2 localization by immunofluorescence

  • Observe formation of cytoplasmic aggregates with truncated mutants

  • Use Western blot under denaturing conditions to detect multimers

• Lysosomal degradation assessment:

  • Treat cells with lysosomal inhibitors:

    • Bafilomycin A₁ (100-200 nM, 4-6h)

    • Chloroquine (10-50 μM, 4-6h)

  • Compare with proteasome inhibitor (MG132, 10 μM, 4-6h)

  • Observe accumulation patterns by Western blot

• Protein stability experiments:

  • Perform cycloheximide chase assays (100 μg/ml)

  • Collect samples at multiple timepoints (0, 3, 6, 9, 12h)

  • Compare degradation rates between wild-type and mutant proteins

• Autophagy flux assessment:

  • Monitor LC3-I to LC3-II conversion by Western blot

  • Use tandem mRFP-GFP-LC3 constructs to differentiate autophagosome formation vs. maturation

  • Compare basal vs. stress-induced autophagy (starvation, rapamycin treatment)

• Protein-protein interaction analysis:

  • Investigate whether mutant OSBPL2 interacts with wild-type protein

  • Use co-immunoprecipitation to detect complex formation

  • Assess dominant-negative potential of mutant proteins