P2RY11 Antibody

What is P2RY11 and why is it important in immunological research?

P2RY11 (purinergic receptor P2Y11) is a 374-amino acid protein belonging to the G-protein coupled receptor 1 family with predicted membrane localization. The receptor is particularly important in immunological research because it senses extracellular ATP during inflammatory and immune responses . P2Y11 expression has been reported in various innate immune cells including dendritic cells and macrophages, as well as in adaptive immune cells, suggesting its critical role in immune regulation . The receptor demonstrates significant involvement in cell survival, cytokine production, cell migration, and cellular differentiation processes . Understanding P2Y11's functions provides valuable insights into immune system modulation and potential therapeutic targets in inflammatory disorders.

What applications are P2RY11 antibodies typically used for in academic research?

P2RY11 antibodies are employed across multiple experimental applications in academic research. Based on commercially available antibodies, the most common applications include:

• Western Blot (WB): For detecting P2RY11 protein expression levels in cell or tissue lysates

• Immunocytochemistry (ICC): For visualizing cellular localization of the receptor

• Immunofluorescence (IF): For high-resolution imaging of receptor distribution

• Immunoprecipitation (IP): For isolating P2RY11 protein complexes

• Enzyme-Linked Immunosorbent Assay (ELISA): For quantitative measurement of P2RY11 levels

• Immunohistochemistry (IHC): For examining receptor expression in tissue sections

Most commercially available antibodies are reactive with human P2RY11, with limited cross-reactivity to other species, reflecting the absence of direct P2RY11 homologs in commonly used laboratory animals such as mice .

How should researchers select the appropriate P2RY11 antibody for their experiments?

When selecting a P2RY11 antibody, researchers should consider several critical factors to ensure experimental success:

• Epitope targeting: Examine whether the antibody targets the N-terminus or C-terminus of P2RY11. C-terminal targeting antibodies will recognize both P2RY11 and the PPAN-P2RY11 fusion protein in immunostaining, though they can be distinguished by western blot due to different molecular weights (approximately 40 kDa for P2RY11 versus 90 kDa for PPAN-P2RY11) .

• Validation evidence: Review published literature or manufacturer data demonstrating the antibody's specificity. The most reliable antibodies have been validated in systems with both positive controls (transfected cells expressing P2RY11) and negative controls (knockout or untransfected cells) .

• Application compatibility: Ensure the antibody has been validated for your specific application (WB, IHC, IF, etc.) as performance can vary significantly between applications.

• Host species considerations: Select an antibody raised in a species that avoids cross-reactivity with secondary detection systems in your experimental design.

• Clonality choice: Polyclonal antibodies may offer greater sensitivity by recognizing multiple epitopes but potentially lower specificity, while monoclonal antibodies typically provide higher specificity but might have reduced sensitivity .

How can researchers distinguish between P2RY11 and PPAN-P2RY11 when detecting expression?

Distinguishing between P2RY11 and the PPAN-P2RY11 fusion transcript/protein represents a significant methodological challenge that has been widely overlooked in the literature. To accurately differentiate between these entities, researchers should implement the following strategies:

For mRNA detection:

• Design primers specifically targeting unique regions of the P2RY11 transcript that are not present in the fusion transcript

• Verify primer specificity using appropriate controls (such as cloned cDNAs of both transcripts)

• Consider Northern blotting as a complementary approach to PCR-based methods

• Be aware that most published studies have used primer sets that likely detect both transcripts, as highlighted in review literature

For protein detection:

• When performing Western blot analysis, carefully assess band sizes, as P2RY11 is approximately 40-45 kDa while PPAN-P2RY11 is approximately 90 kDa

• For immunocytochemistry or immunohistochemistry applications, be aware that C-terminal targeting antibodies will not distinguish between these proteins

• Consider epitope-tagging approaches (such as HA-tagging) of recombinant P2RY11 in experimental systems to enable specific detection

These methodological considerations are essential as studies have demonstrated that detection of P2RY11 mRNA does not always correlate with functional P2RY11 receptor expression, highlighting the importance of combining molecular detection with functional assays.

What validation steps should be taken to ensure P2RY11 antibody specificity?

Given the documented issues with antibody specificity in P2RY11 research, rigorous validation is essential. Researchers should implement multiple validation approaches:

• Positive and negative control testing:

  • Use cells transfected with P2RY11 expression vectors as positive controls

  • Include parallel experiments with non-transfected cells or cells transfected with empty vectors

  • When possible, utilize CRISPR/Cas9-mediated P2RY11 knockout cells as definitive negative controls

• Peptide competition assays:

  • Test signal blocking using the immunogenic peptide, with complete signal abolishment indicating specificity

  • Be skeptical of results where peptide blocking is incomplete, as demonstrated in placental tissue studies

• Size verification in Western blotting:

  • Confirm the detected band appears at the expected molecular weight (approximately 45 kDa for P2RY11)

  • Be aware that glycosylation may result in multiple bands around this size range

• Orthogonal method comparison:

  • Compare antibody-based detection with alternative approaches such as mRNA expression analysis

  • For tagged recombinant P2RY11, compare results using both tag-specific and P2RY11-specific antibodies

• Cross-reactivity examination:

  • Test the antibody against related proteins, particularly other P2Y family members

  • Consider the high sequence similarity (32%) between P2Y11 and P2Y1 receptors

Additionally, researchers should be particularly cautious when working with widely used polyclonal antibodies like #APR-015, which has shown questionable specificity in multiple studies .

How should researchers design functional assays to confirm P2RY11 receptor activity?

Given the discrepancies between P2RY11 mRNA/protein detection and functional receptor presence, comprehensive functional assays are critical. A robust approach includes:

• Signaling pathway activation:

  • Measure cAMP accumulation, as P2RY11 uniquely couples to both G₁₁ (PLC/Ca²⁺) and Gₛ (adenylyl cyclase/cAMP) pathways

  • Assess calcium mobilization through fluorescent calcium indicators

  • Include positive controls using known P2RY11 agonists such as ATP, ATPγS, or the specific agonist NF546

• Pharmacological profiling:

  • Compare responses to ATP with other nucleotides (ADP, UTP) to verify receptor specificity

  • Test selective P2RY11 antagonists (NF340, NF157) to confirm signal inhibition

  • Evaluate NAD⁺ responses, as this is another proposed P2RY11 ligand

• Genetic manipulation approaches:

  • Perform experiments with siRNA knockdown of P2RY11

  • When possible, use CRISPR/Cas9-mediated gene editing to create receptor knockouts

  • Complement with rescue experiments by reintroducing P2RY11 expression

• Heterologous expression systems:

  • Express P2RY11 in cell systems known to lack endogenous expression

  • Use bicistronic expression vectors like pEFIN3 that allow for simultaneous expression of selection markers

By combining these approaches, researchers can establish with confidence whether functional P2RY11 receptors are present in their experimental system.

How does P2RY11 expression correlate with macrophage polarization and what are the implications for immunological research?

Recent research has revealed important relationships between P2RY11 expression and macrophage polarization states, with significant implications for immunological research:

P2RY11 has been found to be upregulated during polarization of M2 macrophages, with particularly enhanced expression during IL-10-mediated differentiation of M2c macrophages that express CD163, CD16, and CD274 (PD-L1) . This correlation suggests P2RY11 may function as a marker or mediator of anti-inflammatory macrophage phenotypes.

The regulatory network governing P2RY11 expression in macrophages involves:

• IL-10 signaling pathways that enhance receptor expression

• p53 stabilization (via nutlin-3a treatment) which further increases P2RY11, CD16, and PD-L1 expression

• AMP-activated kinase (AMPK), which mediates anti-inflammatory effects of IL-10

• Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme of the NAD⁺ salvage pathway

These findings suggest P2RY11 may function at the intersection of cellular metabolism and immune regulation in macrophages. For immunological researchers, this presents opportunities to:

• Investigate P2RY11 as a potential target for modulating macrophage polarization in inflammatory diseases

• Explore the relationship between metabolic pathways (particularly NAD⁺ metabolism) and immune cell function

• Examine P2RY11's role in resolution of inflammation and tissue repair processes

• Develop novel therapeutic approaches targeting the P2RY11 pathway to promote anti-inflammatory phenotypes

When designing experiments to investigate these relationships, researchers should consider combining P2RY11 expression analysis with comprehensive phenotyping of macrophage activation states and metabolic profiling.

What are the key considerations when investigating species differences in P2RY11 expression and function?

A critical consideration in P2RY11 research is the significant species differences in receptor expression, which requires careful experimental design:

The most striking species difference is that murines (mice and rats) do not express a protein directly homologous to human P2RY11. Sequence analysis has found the murine P2Y₁ receptor to be the closest murine protein to human P2RY11, showing only 32% sequence similarity . This fundamental difference has several important implications for researchers:

• Model system selection:

  • Mouse models cannot be used to directly study P2RY11 function

  • Human cell lines or primary human cells are essential for authentic P2RY11 research

  • Humanized mice or transgenic mice expressing human P2RY11 may be valuable alternative models

• Interpretation of "P2Y11-like" receptors:

  • Claims of "P2Y11-like receptors" in murine systems should be treated with extreme caution

  • Antibody-based detection of P2Y11 in murine samples is likely due to cross-reactivity with other P2Y family members

  • Functional responses attributed to P2Y11 in murine systems likely reflect activities of other purinergic receptors

• Translation of research findings:

  • Extrapolating from murine purinergic receptor studies to human P2RY11 function requires careful validation

  • Consider using multiple species when investigating purinergic signaling to identify conserved versus species-specific mechanisms

  • When using primary human cells, account for donor variability that may influence P2RY11 expression levels

• Alternative approaches:

  • Consider heterologous expression of human P2RY11 in murine cell lines for functional studies

  • Explore CRISPR/Cas9 knock-in of human P2RY11 in murine models

  • Utilize comparative genomics to identify the evolutionary basis for species differences in P2Y receptor subtypes

These considerations highlight the importance of carefully selecting appropriate experimental systems when investigating P2RY11 biology.

How can researchers address the discrepancies between P2RY11 mRNA detection and functional receptor expression?

Several studies have reported discrepancies between P2RY11 mRNA detection and functional receptor activity, presenting a significant challenge in P2RY11 research. To address these inconsistencies, researchers should implement a multi-faceted approach:

• Comprehensive mRNA analysis:

  • Use primers specifically designed to distinguish between P2RY11 and PPAN-P2RY11 transcripts

  • Quantify absolute expression levels of P2RY11 mRNA rather than merely detecting presence/absence

  • Consider alternative splicing through techniques like RT-PCR using multiple primer sets spanning different exon junctions

• Protein expression verification:

  • Combine multiple antibody-based approaches targeting different epitopes

  • Use subcellular fractionation to determine membrane localization of the receptor

  • Consider proteomic approaches like mass spectrometry for unbiased protein identification

• Post-translational modification assessment:

  • Investigate glycosylation patterns through enzymatic deglycosylation followed by Western blotting

  • Examine potential phosphorylation states that might regulate receptor trafficking

  • Study receptor internalization and recycling dynamics using surface biotinylation assays

• Heterologous expression systems:

  • Express epitope-tagged P2RY11 in cell lines lacking endogenous expression

  • Create stable cell lines with inducible P2RY11 expression to control expression levels

  • Study the effects of co-expressing interacting proteins that might facilitate surface expression

• Functional correlation analysis:

  • Plot quantitative mRNA and protein expression levels against functional responses

  • Identify threshold expression levels required for detectable receptor function

  • Investigate potential dominant-negative effects of variant transcripts or PPAN-P2RY11

Possible explanations for the observed discrepancies include:

• Very low translation efficiency of P2RY11 mRNA

• Impaired receptor trafficking to the cell surface under basal conditions

• Requirement for specific stimuli to induce functional surface expression

• Formation of heterodimers with other receptors affecting function or detection

By systematically addressing these possibilities, researchers can develop a more complete understanding of the relationship between P2RY11 gene expression and functional receptor activity.

What are common pitfalls in P2RY11 antibody-based experiments and how can they be overcome?

Researchers working with P2RY11 antibodies frequently encounter several technical challenges. Here are common pitfalls and recommended solutions:

• Non-specific antibody binding:

  • Pitfall: Many P2RY11 antibodies show cross-reactivity with other proteins, particularly other P2Y family members.

  • Solution: Implement rigorous blocking protocols, titrate antibody concentrations, and always include appropriate positive and negative controls. Consider using knockout or knockdown validation systems.

• Inconsistent band patterns in Western blotting:

  • Pitfall: P2RY11 detection often yields multiple bands (33-60 kDa range) or unexplained higher molecular weight bands.

  • Solution: Use glycosidase treatments to assess contribution of glycosylation to band patterns. Always include molecular weight markers and consider using tagged recombinant P2RY11 as a size reference .

• PPAN-P2RY11 fusion protein interference:

  • Pitfall: C-terminal antibodies detect both P2RY11 (40-45 kDa) and PPAN-P2RY11 fusion protein (90 kDa).

  • Solution: For Western blotting, carefully distinguish bands by molecular weight. For immunocytochemistry, consider using N-terminal antibodies when available or complement with mRNA analysis using specific primers .

• Background signal in immunostaining:

  • Pitfall: High background can mask specific P2RY11 staining, particularly in tissues with autofluorescence.

  • Solution: Optimize fixation conditions, implement autofluorescence quenching steps, and use appropriate blocking agents matched to the host species of the secondary antibody.

• Epitope masking due to protein interactions:

  • Pitfall: P2RY11 epitopes may be masked by protein-protein interactions or post-translational modifications.

  • Solution: Test multiple fixation and antigen retrieval methods. Consider native versus denaturing conditions depending on the application.

• Batch-to-batch antibody variability:

  • Pitfall: Significant variability between different lots of the same antibody, particularly with polyclonal antibodies.

  • Solution: Purchase sufficient quantities of validated lots for complete study series. Revalidate new antibody lots before use in critical experiments.

By anticipating these challenges and implementing appropriate controls and optimization steps, researchers can significantly improve the reliability of P2RY11 antibody-based experiments.

How should researchers interpret conflicting results between different detection methods for P2RY11?

When faced with conflicting results between different P2RY11 detection methods, researchers should follow a systematic interpretation approach:

• Hierarchical reliability assessment:

  • Functional assays with pharmacological validation generally provide the most reliable evidence of P2RY11 activity

  • Protein detection methods vary in reliability: tagged recombinant proteins > validated antibodies against endogenous protein > antibodies with limited validation

  • mRNA detection is reliable for gene expression but does not guarantee protein expression or functionality

• Methodological cross-validation:

  • When RT-PCR and protein detection methods show discrepancies, verify primer specificity (particularly regarding P2RY11 vs. PPAN-P2RY11 discrimination)

  • If protein is detected but functional assays are negative, examine receptor localization (surface vs. intracellular)

  • When functional responses suggest P2RY11 activity but protein is undetectable, consider assay sensitivity limitations or potential indirect effects

• Context-dependent expression:

  • Consider whether cell activation state influences receptor expression

  • Examine temporal dynamics, as receptor expression may be transient

  • Investigate whether specific culture conditions affect receptor expression or function

• Technical limitations analysis:

  • Assess sensitivity thresholds of each method

  • Consider whether post-translational modifications affect detection

  • Evaluate potential interference from related family members

The published literature has documented several instances where P2RY11 mRNA detection was not associated with functional receptor expression. For example, NT-2 cells were shown to express P2RY11 mRNA, but ATP treatment did not increase cAMP levels as would be expected with functional P2Y11 receptors . Similarly, CD4+ T lymphocytes expressing P2RY11 transcripts showed no cAMP response to P2Y11 agonists, and prostate cancer cells with detectable P2RY11 mRNA exhibited a pharmacological profile inconsistent with functional P2Y11 receptors .

These documented discrepancies highlight the importance of using multiple, complementary approaches when studying P2RY11 biology and exercising caution when interpreting results from any single detection method.

What strategies can researchers employ to improve reproducibility in P2RY11 antibody research?

Reproducibility challenges in P2RY11 antibody research can be addressed through these comprehensive strategies:

• Antibody validation and reporting:

  • Implement a multi-step validation protocol for each antibody lot

  • Document complete antibody information in publications (supplier, catalog number, lot number, dilution, validation methods)

  • Share validation data through repositories such as Antibodypedia or the Antibody Registry

  • Consider using at least two different antibodies targeting distinct epitopes

• Experimental design considerations:

  • Include biological and technical replicates in sufficient numbers

  • Implement blinded analysis when scoring staining patterns or measuring band intensities

  • Pre-register experimental protocols when possible

  • Use positive and negative controls systematically in each experiment

• Standardized protocols:

  • Develop and adhere to standard operating procedures for sample preparation

  • Control for variables that might affect P2RY11 expression or detection (cell density, passage number, stimulation conditions)

  • Use consistent lysis buffers, blocking agents, and detection methods across experiments

  • Implement quantitative analysis methods rather than qualitative assessments

• Data sharing and transparency:

  • Present unprocessed original images in publications or supplementary materials

  • Provide access to original data through repositories

  • Report negative results alongside positive findings

  • Disclose all experimental conditions, including those that were unsuccessful

• Collaborative validation:

  • Participate in multi-laboratory validation studies

  • Consider independent replication of key findings before publication

  • Establish reference standards for P2RY11 expression and detection

By implementing these strategies, researchers can significantly improve reproducibility in P2RY11 antibody research, addressing the documented concerns about antibody specificity and experimental consistency in this challenging field.

How can CRISPR/Cas9 gene editing be leveraged to advance P2RY11 receptor research?

CRISPR/Cas9 technology offers powerful approaches to overcome longstanding challenges in P2RY11 research:

• Generation of validated cellular models:

  • Creating P2RY11 knockout cell lines provides essential negative controls for antibody validation and functional studies

  • The search results describe specific crRNAs successfully used for P2RY11 targeting: "CTGCCGACGACAAACTCAGT" (position 254-273) and "TGCTCAACGTGGATGCTCGG" (position 1007-1026)

  • These crRNAs can be combined with tracrRNA to form functional guide RNAs for CRISPR/Cas9-mediated gene editing

• Epitope tagging of endogenous receptor:

  • Knock-in of epitope tags (HA, FLAG, etc.) at the endogenous P2RY11 locus enables specific detection without relying on P2RY11 antibodies

  • This approach preserves endogenous expression levels and regulatory mechanisms

  • C-terminal tagging helps distinguish between P2RY11 and PPAN-P2RY11 proteins in immunostaining applications

• Functional domain analysis:

  • Introduction of precise point mutations to investigate structure-function relationships

  • Mapping of critical residues for ligand binding and G-protein coupling

  • Investigation of post-translational modification sites through mutation of specific residues

• Manipulation of regulatory regions:

  • Targeting promoter or enhancer regions to understand transcriptional regulation

  • Creating reporter knock-ins to monitor P2RY11 expression dynamics in real-time

  • Disrupting specific splicing regulatory elements to investigate transcript variants

• Analysis of receptor interactions:

  • Introducing proximity labeling tags (BioID, APEX) to identify interacting proteins

  • Creating fluorescent protein fusions to study receptor trafficking and localization

  • Generating mutations that disrupt predicted protein-protein interaction domains

The implementation of these CRISPR/Cas9 approaches will significantly advance understanding of P2RY11 biology by providing more reliable tools for receptor detection and manipulation than have been available historically.

What role does P2RY11 play in receptor dimerization and how can this be investigated?

P2RY11 receptor dimerization represents an intriguing aspect of receptor function that merits targeted investigation:

The scientific literature indicates that P2RY11 forms heterodimers with P2Y1 receptors , suggesting that receptor dimerization may be an important regulatory mechanism affecting P2RY11 function. This phenomenon has several implications and can be investigated through multiple approaches:

• Functional consequences of dimerization:

  • Altered ligand binding properties

  • Modified G-protein coupling preferences

  • Changes in receptor trafficking and surface expression

  • Potential creation of novel pharmacological profiles

• Experimental approaches to study P2RY11 dimerization:

  • Bioluminescence resonance energy transfer (BRET) or fluorescence resonance energy transfer (FRET) to detect protein-protein interactions

  • Proximity ligation assays (PLA) for detecting interactions in fixed cells or tissues

  • Co-immunoprecipitation studies using differentially tagged receptors

  • Chemical crosslinking followed by immunoblotting or mass spectrometry

  • Single-molecule imaging techniques to visualize receptor complexes

• Investigating dimerization interfaces:

  • Generating truncation mutants to map interaction domains

  • Creating chimeric receptors between P2RY11 and non-dimerizing receptors

  • Using peptide competition assays with synthetic peptides corresponding to potential interaction interfaces

  • Computational modeling of potential dimerization interfaces

• Pharmacological modulation of dimers:

  • Testing whether specific ligands promote or disrupt dimerization

  • Developing bivalent ligands targeting receptor heterodimers

  • Investigating allosteric regulation between dimerized receptors

• Physiological relevance assessment:

  • Examining co-expression patterns of P2RY11 and potential dimerization partners

  • Studying whether cellular activation states affect dimerization dynamics

  • Investigating whether pathological conditions alter receptor complex formation

Understanding P2RY11 dimerization may help explain some of the discrepancies observed between receptor expression and function, as dimerization could significantly modify receptor properties and detection.

How can researchers investigate the relationship between P2RY11 and cellular metabolism, particularly regarding NAD+ signaling?

Recent research suggests intriguing connections between P2RY11 and cellular metabolism, particularly involving NAD+ signaling, which can be investigated through several approaches:

• NAD+ as a potential P2RY11 ligand:

  • NAD+ has been proposed as a P2RY11 receptor ligand in addition to ATP

  • Comparative pharmacological profiling using ATP, NAD+, and structural analogs

  • Investigation of binding site specificity through site-directed mutagenesis

  • Development of selective ligands that distinguish between ATP and NAD+ binding sites

• Regulatory pathways connecting P2RY11 and NAD+ metabolism:

  • Research indicates that nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme of the NAD+ salvage pathway, is required for P2RY11 expression

  • AMP-activated kinase (AMPK), which mediates anti-inflammatory effects of IL-10, also regulates P2RY11 expression

  • Experimental manipulation of these pathways using:

    • NAMPT inhibitors (e.g., FK-866)

    • NAD+ precursors (e.g., NMN)

    • AMPK modulators (e.g., Compound C, AICAR)

    • SIRT1 inhibitors (e.g., EX-527)

• Metabolic profiling approaches:

  • Measure NAD+/NADH ratios in cells with different P2RY11 expression levels

  • Perform metabolomics analysis of P2RY11 knockout versus wild-type cells

  • Investigate mitochondrial function in relation to P2RY11 activation

  • Examine glycolytic versus oxidative metabolism in cells with modulated P2RY11 activity

• Integration with immune cell polarization:

  • Analyze metabolic changes during macrophage polarization in relation to P2RY11 expression

  • Investigate how metabolic interventions affect P2RY11-dependent immune functions

  • Examine NAD+ consumption pathways (e.g., PARPs, CD38) in relation to P2RY11 signaling

• Disease-relevant models:

  • Study P2RY11 expression and function in metabolic disorders

  • Investigate potential metabolic roles in inflammatory conditions

  • Examine P2RY11-dependent metabolic adaptations during cellular stress

These research directions could significantly advance understanding of how P2RY11 functions at the intersection of purinergic signaling, metabolism, and immune regulation, potentially revealing new therapeutic targets for inflammatory and metabolic diseases.