REG3A Antibody

What is REG3A and what cellular functions does it regulate?

REG3A (Regenerating islet-derived protein 3-alpha) is a C-type lectin antimicrobial protein that plays crucial roles in tissue regeneration, proliferation regulation, and immune defense. In human tissues, REG3A functions in multiple pathways:

• Acts as an antimicrobial protein in epithelial defense mechanisms

• Regulates keratinocyte proliferation by inhibiting terminal differentiation gene expression (including keratin-10, filaggrin, and loricrin)

• Mediates wound healing responses, with significantly increased expression at wound edges compared to normal skin

• Contributes to hyperproliferative conditions in the epidermis, including psoriasis

• Activates the Akt-mTOR signaling cascade, supporting cell proliferation and survival

The protein is expressed prominently in small intestine tissue and can be detected in cancer cell lines including HepG2 hepatocellular carcinoma cells, with localization primarily in the cytoplasm . Recent research indicates REG3A binds to the EXTL3 receptor on keratinocytes, through which it exerts its biological effects on differentiation and proliferation .

What are the optimal applications for detecting REG3A using antibody-based methods?

REG3A detection can be accomplished through several antibody-based techniques, each with specific optimization parameters:

Western Blot Detection:

• Human REG3A appears as a specific band at approximately 17 kDa under reducing conditions

• Optimal antibody concentrations range from 1-2 μg/mL depending on the specific antibody used

• PVDF membranes are recommended for optimal protein transfer and detection

• Human small intestine tissue lysates serve as positive controls for validation

Immunohistochemistry/Immunocytochemistry:

• Paraffin-embedded tissues can be probed with monoclonal antibodies like clone 8B11.1

• Fixed cell applications (such as HepG2 cells) can be conducted with 10 μg/mL antibody concentration for approximately 3 hours at room temperature

• Visualization typically employs fluorescent secondary antibodies, with counterstaining using DAPI to visualize nuclei

• REG3A exhibits predominantly cytoplasmic localization in positive cells

To ensure specificity, controls should include tissues known to express REG3A (small intestine) and knockout/knockdown validation when available.

How does REG3A expression vary across different human tissues and disease states?

REG3A exhibits tissue-specific expression patterns that change significantly in various pathological states:

Normal Tissues:

• Highly expressed in small intestine epithelium

• Low baseline expression in normal epidermal keratinocytes

• Limited expression in normal breast tissue

Disease States:

• Significantly upregulated in psoriatic skin lesions compared to normal skin

• Dramatically increased at wound edges during repair processes

• Overexpressed in triple-negative breast cancer (TNBC) tissues compared to adjacent normal tissues

• Detected in HepG2 hepatocellular carcinoma cells

• Associated with inflammation in various tissues, including potential roles in sarcoidosis and fibrosis

These expression patterns suggest REG3A functions as a stress-response protein with dual roles in tissue regeneration and antimicrobial defense. The significant upregulation in hyperproliferative conditions and cancers indicates its potential value as both a biomarker and therapeutic target .

What approaches can be used to study REG3A's role in regulating the Akt-mTOR signaling pathway?

Investigating REG3A's involvement in Akt-mTOR signaling requires sophisticated experimental designs:

Knockdown/Knockout Followed by Pathway Analysis:

• REG3A silencing using validated shRNAs (targeting sequences: "CTGTAATGTGAGGTTACCCTATGTC," "TGTTTGGTGTGCAACTCATCATG," or "CCCTGGTGAAGAGCATTGGTAAC") demonstrates decreased phosphorylation of Akt-S6K1

• CRISPR-sgRNA targeting REG3A can be employed for complete knockout studies

• Comparative phosphoproteomics between control and REG3A-deficient cells reveals downstream targets

Rescue Experiments:

• Constitutively active mutant S473D Akt1 (caAkt1) expression can restore Akt-mTOR pathway activation and reverse proliferation inhibition caused by REG3A knockdown

• Overexpression of wild-type REG3A provides gain-of-function validation of pathway activation

mTOR Complex Analysis:

• Co-immunoprecipitation assays can determine how REG3A influences mTOR complex formation and integrity

• Assessment of REG3A interactions with specific mTOR complex components helps elucidate mechanistic details

These methodological approaches have revealed that REG3A plays a crucial role in maintaining mTOR complex integrity and activating the Akt-mTOR cascade, which has significant implications for cell proliferation, survival, and potential therapeutic targeting .

How does IL-17 signaling interact with REG3A expression in inflammatory skin conditions?

IL-17 and REG3A demonstrate significant regulatory interactions in inflammatory skin conditions that can be investigated through several methodological approaches:

Induction Studies:

• Treatment of normal human epidermal keratinocytes (NHEKs) with IL-17A directly induces REG3A expression in a dose-dependent manner

• Quantitative RT-PCR reveals increased REG3A mRNA levels upon exposure to IL-17A

• Increased REG3A protein is detectable by immunohistochemistry in IL-17A-treated keratinocytes

Receptor Dependency:

• IL-17 receptor A (IL-17RA) knockdown using targeted shRNAs effectively inhibits IL-17A-induced REG3A expression

• This confirms the IL-17RA dependency of the regulatory pathway

In Vivo Models:

• In mouse models, administration of IL-17a-neutralizing antibody into skin wounds decreases both mRNA and protein expression of RegIIIγ (the mouse homolog of human REG3A)

• The supernatant from wounded skin homogenate increases RegIIIγ expression in primary murine epidermal keratinocytes, which can be abrogated by mouse IL-17a-neutralizing antibody

Genetic Models:

• IL-17-knockout mice (Il17-/-) demonstrate altered expression of REG3A homologs in skin, confirming the in vivo relevance of this regulatory relationship

These findings establish a clear mechanistic link between IL-17 signaling and REG3A expression in inflammatory skin conditions, providing potential therapeutic targets for conditions like psoriasis where both IL-17 and REG3A are upregulated .

What techniques can determine the functional consequences of REG3A-EXTL3 receptor binding?

The interaction between REG3A and its receptor EXTL3 represents a crucial mechanistic aspect of REG3A function that can be investigated through several approaches:

Physical Interaction Studies:

• Co-immunoprecipitation assays with REG3A antibody followed by detection with EXTL3 antibody (or vice versa) confirm direct physical interaction

• This interaction can be demonstrated in both REG3A-treated keratinocytes and tissue samples

Functional Validation through Silencing:

• EXTL3 silencing through targeted shRNAs blocks REG3A's inhibitory effect on differentiation markers like loricrin in normal human epidermal keratinocytes (NHEKs)

• EXTL3 knockdown also inhibits REG3A-induced cell proliferation, establishing the receptor's necessity for REG3A's biological effects

In Vivo Blocking Studies:

• Administration of EXTL3 antibodies into mouse back skin abrogates the inhibitory effects of RegIIIγ (mouse homolog) on both mRNA and protein expression of loricrin in wounds

• This approach validates the in vivo relevance of the REG3A-EXTL3 interaction

Receptor Specificity:

• Experiments with alternative receptors like mannose receptor c-type 1 (MRC1), which binds other C-type lectins, show no effect on loricrin expression when silenced, confirming EXTL3 specificity

• This contrasts with the clear effects seen with EXTL3 manipulation

These methodological approaches reveal that REG3A binding to EXTL3 is essential for its effects on keratinocyte differentiation and proliferation, providing insight into how REG3A mediates its biological functions in various tissues and disease states .

What are the optimal sample preparation methods for REG3A detection in different tissue types?

Successful REG3A detection requires tissue-specific sample preparation protocols:

Small Intestine Tissue:

• Complete tissue lysis under reducing conditions is essential for Western blot applications

• Appropriate homogenization buffers containing protease inhibitors preserve protein integrity

• For immunohistochemistry, proper fixation and antigen retrieval are crucial for epitope preservation

Skin Samples (Normal and Psoriatic):

• Flash freezing followed by sectioning yields optimal results for both protein and RNA extraction

• For wound healing studies, precise sampling of the wound edge is critical, as REG3A expression is highly localized

• Paraffin embedding with appropriate fixation preserves morphology for immunohistochemical analysis

Cancer Tissues (e.g., TNBC):

• Paired sampling of tumor tissue with adjacent normal tissue provides essential controls

• Flash freezing in liquid nitrogen followed by controlled thawing minimizes protein degradation

• Cell lines should be harvested at 70-80% confluence for optimal protein expression analysis

Technical Parameters:

• For Western blot, PVDF membranes yield better results than nitrocellulose for REG3A detection

• Reducing conditions are essential for proper denaturation and band visualization at the expected 17 kDa size

• For immunofluorescence, cytoplasmic localization requires appropriate permeabilization protocols

These tissue-specific considerations ensure reliable and reproducible detection of REG3A across different experimental contexts and applications.

How can researchers validate REG3A antibody specificity for experimental applications?

Rigorous validation of REG3A antibody specificity requires multiple complementary approaches:

Recombinant Protein Controls:

• Testing against E. coli-derived recombinant human REG3A (specifically Glu27-Asp175, Accession # Q06141) confirms target recognition

• Pre-absorption with recombinant protein should abolish specific staining in immunohistochemistry applications

Cross-Reactivity Assessment:

• Direct ELISA evaluation against related proteins reveals potential cross-reactivity (e.g., approximately 5% cross-reactivity with recombinant human Reg3G, recombinant mouse Reg3A, Reg3B, and recombinant rat Reg2)

• Testing against rhReg1A, rhReg1B, rmRegIV, rmReg2, and rmReg3D (which show <2% cross-reactivity) confirms specificity

Genetic Validation:

• Utilizing REG3A knockout/knockdown models provides the most definitive validation

• Comparing antibody signals between wild-type and shRNA-treated cells (targeting sequences: "CTGTAATGTGAGGTTACCCTATGTC," "TGTTTGGTGTGCAACTCATCATG," or "CCCTGGTGAAGAGCATTGGTAAC") confirms specificity

Multiple Detection Methods:

• Correlation between protein detection methods (Western blot, immunohistochemistry) and mRNA expression (qRT-PCR) provides orthogonal validation

• Proper positive controls (small intestine tissue) and negative controls (tissues known to lack REG3A expression) should be included in all experiments

Implementing these validation strategies ensures experimental reliability and enables accurate interpretation of results in REG3A research applications.

What are common pitfalls in REG3A detection and how can they be addressed?

Researchers frequently encounter specific challenges when working with REG3A antibodies that require methodological solutions:

Western Blot Issues:

• Problem: Nonspecific bands around 17 kDa
  Solution: Increase blocking time/concentration and optimize antibody dilution; validate with REG3A-knockdown controls

• Problem: Weak or absent signal despite known REG3A expression
  Solution: Ensure sample preparation under reducing conditions; increase protein loading; verify tissue source (small intestine provides robust positive control)

Immunohistochemistry Challenges:

• Problem: High background staining
  Solution: Optimize blocking protocols; increase antibody dilution; include appropriate isotype controls

• Problem: False-negative results in paraffin sections
  Solution: Implement heat-induced epitope retrieval; verify antigen preservation during fixation; confirm antibody compatibility with paraffin embedding

Cell-Specific Considerations:

• Problem: Variable expression in cultured cells
  Solution: Standardize culture conditions; consider IL-17A treatment to upregulate expression for detection; use HepG2 cells as positive control

• Problem: Difficult detection in normal keratinocytes
  Solution: Create wound-like conditions or IL-17A stimulation to induce expression; compare with psoriatic samples as positive controls

Cross-Reactivity Management:

• Problem: Antibody cross-reactivity with related proteins
  Solution: Include recombinant protein competition assays; validate with genetic knockdown/knockout approaches; verify results with multiple antibody clones

These troubleshooting strategies address common technical challenges in REG3A detection, enabling more reliable and reproducible experimental results.

How can researchers optimize dual staining protocols for REG3A and its interacting partners?

Investigating REG3A's interactions with binding partners and signaling components requires sophisticated co-localization approaches:

REG3A-EXTL3 Co-Localization:

• Implement sequential staining protocols with distinct fluorophores (e.g., Northern-Lights™ 557 for REG3A and a spectrally distinct fluorophore for EXTL3)

• Include appropriate controls for antibody cross-reactivity and fluorophore bleed-through

• Consider proximity ligation assays (PLA) to visualize direct protein-protein interactions within cellular compartments

REG3A and Akt-mTOR Pathway Components:

• For phosphorylated targets, quick fixation with phosphatase inhibitors is essential to preserve phosphorylation states

• Use antibodies from different host species to enable simultaneous detection

• Sequential staining may be necessary if both primary antibodies are from the same species

Technical Optimization Parameters:

• Fixation: Optimize fixation duration to preserve both REG3A epitopes and binding partner epitopes

• Permeabilization: Titrate detergent concentration to enable antibody access while preserving protein interactions

• Antibody Order: Test both staining sequences to determine optimal signal-to-noise ratio

• Signal Amplification: Consider tyramide signal amplification for weakly expressed binding partners

Imaging Considerations:

• High-resolution confocal microscopy with appropriate controls for channel bleed-through

• Z-stack acquisition to verify true co-localization versus superimposition

• Quantitative co-localization analysis using appropriate software and statistical measures

These methodological considerations enable precise visualization of REG3A's interactions with signaling partners and receptors, providing spatial context to biochemical interaction data.