PCBP2 Antibody

What is PCBP2 and why is it important in molecular biology research?

PCBP2 belongs to the poly(C)-binding protein family characterized by triple KH (K-homologous) domains that mediate binding to nucleic acids, particularly poly(C) stretches. The protein is approximately 38-39 kDa and serves multiple functions in cellular processes:

• RNA stability regulation, particularly for mRNAs containing C-rich elements in their 3' UTRs

• Post-transcriptional regulation of gene expression

• Viral RNA replication for certain viruses

• Modulation of innate immune responses

PCBP2 is primarily expressed in the nucleus but can shuttle between the nucleus and cytoplasm, allowing it to participate in both nuclear and cytoplasmic processes. The protein has been implicated in several physiological and pathological processes, making PCBP2 antibodies valuable tools for investigating these mechanisms .

What applications are PCBP2 antibodies most commonly used for?

PCBP2 antibodies are versatile reagents employed across multiple experimental techniques:

These applications have been validated with multiple PCBP2 antibodies across human, mouse, and rat samples, making them useful for comparative species studies .

What are the recommended positive controls for PCBP2 antibody validation?

When validating PCBP2 antibodies, several well-established controls should be considered:

• Cell lines: HeLa, Jurkat, K-562, and 293T cells consistently show detectable PCBP2 expression

• Tissues: Human testis, liver, colon, and cervical tissues show positive IHC staining

• Molecular controls: Recombinant PCBP2 protein (particularly GST-tagged versions)

• Negative controls: Non-transfected cell lysates in comparison with PCBP2-transfected lysates

• Knockdown validation: siRNA or shRNA against PCBP2 to confirm antibody specificity

For RNA interference validation, researchers have successfully used the siRNA sequence "CCU CUA GAG GCC UAU ACC A" targeting PCBP2, which provides an excellent negative control for antibody specificity testing .

What are the typical challenges in detecting PCBP2 in tissue samples?

Several technical considerations should be addressed when using PCBP2 antibodies for tissue analysis:

• Antigen retrieval: For FFPE tissues, TE buffer pH 9.0 is recommended for optimal epitope exposure, though citrate buffer pH 6.0 can also be used as an alternative

• Antibody concentration: IHC applications typically require higher concentrations (1:50-1:200) compared to WB applications

• Cross-reactivity: PCBP2 shares sequence homology with other PCBP family members, particularly PCBP1, requiring careful antibody selection to avoid cross-reactivity

• Background staining: PCBP2 is widely expressed, which can sometimes result in higher background signals

• Species differences: While sequence homology is high (mouse 100%, rat 97%), certain epitopes may show species-specific differences in detection efficiency

How should PCBP2 antibodies be stored and handled for optimal performance?

Proper storage and handling are critical for maintaining antibody performance:

• Store concentrated antibody solutions at -20°C for long-term storage (typically stable for one year)

• For frequent use, aliquot and store at 4°C for up to one month

• Avoid repeated freeze-thaw cycles which can degrade antibody quality

• Most PCBP2 antibodies are supplied in PBS with 0.02% sodium azide and 50% glycerol at pH 7.2-7.3

• Briefly centrifuge vials before opening to collect solution at the bottom

• For dilution, use fresh buffers appropriate for the application (e.g., TBST with 5% BSA or milk for WB)

How can PCBP2 antibodies be used to investigate its role in antiviral immune responses?

PCBP2 has been identified as a critical regulator of cGAS-STING antiviral signaling pathways. Research methodologies using PCBP2 antibodies have revealed:

• Protein-protein interactions: Co-immunoprecipitation with PCBP2 antibodies followed by mass spectrometry identified PCBP2 as a cGAS-interacting protein

• Domain mapping: Using PCBP2 antibodies with deletion mutants revealed that the KH3 domain of PCBP2 is critical for its interaction with cGAS

• Signal pathway analysis: PCBP2 overexpression reduces cGAS-STING signaling while PCBP2 knockdown enhances innate immune responses to DNA stimulation

Methodological approach for investigating PCBP2-cGAS interactions:

• Use PCBP2 antibodies to perform co-IP assays with cGAS

• Compare phosphorylation levels of downstream molecules (TBK1, IRF3) in wild-type versus PCBP2-deficient cells

• Measure transcriptional levels of antiviral genes (IFNB1, IFIT1) after viral challenge in cells with modified PCBP2 expression

Research has shown that PCBP2 negatively regulates cGAS enzymatic activity, attenuates cGAS aggregates, and affects cGAS-DNA phase separation, all of which can be monitored using appropriate PCBP2 antibodies in combination with functional assays .

What methodological considerations are important when using PCBP2 antibodies in RNA-binding protein studies?

PCBP2 is a key RNA-binding protein with specificity for C-rich sequences. When investigating RNA-protein interactions:

• RIP (RNA immunoprecipitation) assays:

  • Use PCBP2 antibodies optimized for IP applications

  • Include appropriate RNase inhibitors in all buffers

  • Validate with known PCBP2 RNA targets (e.g., α-globin mRNA)

  • Sequence captured RNAs to identify novel binding partners

• RNA stability assays:

  • Compare mRNA half-life in PCBP2 knockdown versus control cells

  • Focus on transcripts containing C-rich elements in their 3' UTRs

  • Use actinomycin D to block transcription and monitor decay rates

• Mapping binding sites:

  • Combine PCBP2 immunoprecipitation with RNA footprinting

  • Use deletion mutants of target RNAs to identify critical binding regions

Research has demonstrated that PCBP2 stabilizes sortilin transcripts by binding to C-rich elements (CREs) in the 3' UTR. This interaction is sensitive to Zn²⁺ levels, suggesting that PCBP2 may function as a zinc sensor in post-transcriptional regulation .

How can PCBP2 antibodies be used effectively in knockout/knockdown validation experiments?

Rigorous validation of PCBP2 antibodies in genetic manipulation experiments is essential:

• CRISPR-Cas9 knockout approaches:

  • Design guide RNAs targeting PCBP2 exons (e.g., "AAGATGGGCGGGAGTCTTCT" has been successful)

  • Validate knockout by WB with PCBP2 antibodies targeting different epitopes

  • Use immunofluorescence co-staining to confirm cell-specific deletion in mixed populations

• siRNA/shRNA knockdown optimization:

  • Effective sequences include "CCU CUA GAG GCC UAU ACC A" for human PCBP2

  • Test knockdown efficiency at 48-72 hours post-transfection

  • Quantify reduction by densitometry of Western blots (expect 70-80% reduction)

• Tissue-specific knockout models:

  • For pancreatic β cell-specific deletion, RIP-Cre mice crossed with floxed Pcbp2 resulted in ~80% depletion

  • Validate by co-immunofluorescence for PCBP2 and cell-type markers (e.g., insulin)

Recent research using PCBP2 antibodies has shown that β cell-specific knockout of PCBP2 affects insulin secretion in response to cAMP-mediated stimulation (IBMX), highlighting its role in pancreatic function .

What approaches can be used to study PCBP2 domain-specific functions using antibodies?

PCBP2 contains three KH domains with distinct functions. To investigate domain-specific roles:

• Domain mapping strategy:

  • Generate deletion constructs lacking specific KH domains (KH1, KH2, linker, or KH3)

  • Perform co-IP experiments with domain mutants and interaction partners

  • Use Surface Plasmon Resonance (SPR) assays to quantify binding affinities

• Functional rescue experiments:

  • Deplete endogenous PCBP2 via RNAi or CRISPR

  • Reconstitute with domain deletion mutants

  • Assess functional recovery using appropriate readouts

• Domain-specific antibody approaches:

  • Use epitope-specific antibodies targeting different regions of PCBP2

  • Compare immunoprecipitation profiles to identify domain-specific interaction partners

Research has identified that the KH3 domain is critical for PCBP2-cGAS interactions and subsequent regulation of antiviral signaling. Deletion of this domain results in loss of PCBP2's ability to regulate cGAS-STING activation, while other domain deletions maintain this functionality .

How can PCBP2 antibodies be applied in studies of post-translational modifications?

Investigating PCBP2 post-translational modifications requires specific methodological considerations:

• Phosphorylation analysis:

  • Immunoprecipitate PCBP2 using validated antibodies

  • Perform Western blot with phospho-specific antibodies

  • Alternatively, use mass spectrometry to identify modification sites

  • Compare modification patterns before and after cellular stimulation

• Subcellular distribution changes:

  • Use fractionation followed by Western blot with PCBP2 antibodies

  • Perform immunofluorescence to track relocalization after stimulation

  • Quantify nuclear/cytoplasmic ratios under different conditions

• Modification-dependent interactions:

  • Compare PCBP2 interactome before and after specific cellular stimuli

  • Use phosphatase treatment to determine phosphorylation-dependent interactions

While less studied than some aspects of PCBP2 biology, post-translational modifications may be important for regulating PCBP2's RNA-binding activity and protein-protein interactions, particularly in response to cellular stress or immune stimulation .

How can researchers address non-specific binding in Western blot applications?

When encountering non-specific bands with PCBP2 antibodies:

• Optimization strategies:

  • Increase antibody dilution (test range from 1:1000-1:6000)

  • Use freshly prepared blocking solution (5% non-fat milk or BSA)

  • Extend blocking time to reduce background

  • Add 0.1-0.3% Tween-20 to washing buffers

  • Consider using PVDF membranes instead of nitrocellulose for certain applications

• Controls to include:

  • PCBP2 knockdown or knockout lysates as negative controls

  • Recombinant PCBP2 protein as positive control

  • Multiple cell lines to confirm consistent banding pattern

• Expected molecular weight variations:

  • Full-length human PCBP2: 38-39 kDa (calculated 38.6 kDa)

  • GST-tagged PCBP2: ~65 kDa (GST tag adds ~26 kDa)

  • Transfected PCBP2 lysates typically show bands at 38.7 kDa

Many researchers observe PCBP2 at a slightly higher apparent molecular weight (~43 kDa) than calculated, which is likely due to post-translational modifications or the protein's structural properties .

What control experiments should be conducted when using PCBP2 antibodies in co-immunoprecipitation studies?

For robust co-IP experiments with PCBP2 antibodies:

• Essential controls:

  • IgG control from same species as PCBP2 antibody

  • Input sample (5-10% of lysate used for IP)

  • Reciprocal IP (pull down with antibody against interacting partner)

  • Knockdown/knockout controls to establish specificity

• Technical considerations:

  • Pre-clear lysates with protein A/G beads before IP

  • Optimize salt concentration in wash buffers

  • Test different lysis conditions (NP-40, RIPA, etc.)

  • Consider crosslinking for transient interactions

• Validation approaches:

  • Confirm interactions by alternative methods (e.g., proximity ligation assay)

  • Use domain mutants to map interaction interfaces

  • Test interaction under different cellular conditions

Research using PCBP2 antibodies in co-IP experiments has successfully identified its interaction with cGAS, revealing a critical role in regulating antiviral signaling pathways. These studies employed mass spectrometry following co-IP to identify novel interaction partners, providing a model for similar approaches .

What factors influence PCBP2 detection in immunofluorescence experiments?

To optimize immunofluorescence staining with PCBP2 antibodies:

• Fixation and permeabilization:

  • Compare paraformaldehyde (4%) versus methanol fixation

  • Test different permeabilization agents (0.1-0.5% Triton X-100, 0.1% saponin)

  • Optimize incubation times for each step

• Antibody concentration and incubation:

  • Start with 1:50-1:200 dilution range

  • Test both overnight 4°C and room temperature incubations

  • Consider using signal amplification for low abundance detection

• Subcellular localization expectations:

  • Predominantly nuclear staining in most cell types

  • Some cytoplasmic staining depending on cell type and condition

  • Dynamic shuttling between compartments under certain stimuli

• Validation approaches:

  • Include PCBP2 knockdown controls

  • Co-stain with markers for different subcellular compartments

  • Compare staining pattern with multiple PCBP2 antibodies

Immunofluorescence studies using PCBP2 antibodies have been successfully performed in HeLa cells at concentrations around 10 μg/ml, revealing primarily nuclear localization with some cytoplasmic distribution .

How can specificity of PCBP2 antibodies be verified across different experimental systems?

Comprehensive validation of PCBP2 antibodies should include:

• Cross-species validation:

  • Test reactivity in human, mouse, and rat samples

  • Compare staining patterns across species

  • Be aware that some epitopes may show species-specific differences

• Cross-reactivity assessment:

  • Test against recombinant PCBP family members (PCBP1, PCBP3, PCBP4)

  • Use siRNA against specific family members to confirm specificity

  • Compare reactivity patterns with different antibodies against the same target

• Application-specific validation:

  • Perform peptide competition assays

  • Use genetic knockdown/knockout models

  • Compare results from different detection methods

• Epitope-specific considerations:

  • Antibodies raised against different epitopes may perform differently

  • N-terminal vs. C-terminal antibodies may detect different isoforms

  • Structural epitopes may be affected by protein conformation

Most commercial PCBP2 antibodies show reactivity to human, mouse, and rat samples, with sequence homology of 100% for mouse and 97% for rat compared to human PCBP2 .

How are PCBP2 antibodies being used to understand its role in disease mechanisms?

PCBP2 antibodies have revealed important roles in several disease contexts:

• Viral infections:

  • PCBP2 regulates antiviral signaling through the cGAS-STING pathway

  • Knockout of PCBP2 enhances type I interferon responses and reduces HSV-1 replication

  • PCBP2 antibodies help track protein expression during viral infection

• Cancer biology:

  • PCBP2 regulates p73 expression and p73-dependent apoptosis

  • Antibody-based studies have identified aberrant PCBP2 expression in various cancers

  • PCBP2 stabilizes mRNAs encoding key cancer-related proteins

• Metabolic disorders:

  • PCBP2 maintains pancreatic β cell function and insulin secretion

  • β cell-specific deletion of PCBP2 affects cAMP-mediated insulin secretion

  • PCBP2 antibodies enable tracking of expression in specific cell populations

Research using PCBP2 antibodies has shown that PCBP2 knockdown significantly enhances the mRNA expression of interferon-responsive genes following viral infection, suggesting potential therapeutic approaches targeting this pathway .

What emerging techniques are enhancing PCBP2 antibody-based research?

Novel methodologies incorporating PCBP2 antibodies include:

• Proximity-dependent labeling:

  • BioID or APEX2 fusions with PCBP2 to identify spatial interactomes

  • Proximity ligation assays to visualize protein-protein interactions in situ

  • Combined with PCBP2 antibodies for validation

• Live-cell imaging approaches:

  • Complementing fixed-cell antibody studies with tagged PCBP2 in live cells

  • Single-molecule tracking to monitor RNA-protein dynamics

  • FRAP (Fluorescence Recovery After Photobleaching) to measure kinetics

• Single-cell techniques:

  • Combining PCBP2 antibodies with single-cell RNA-seq

  • CyTOF or spectral cytometry for multiparameter analysis

  • Spatial transcriptomics with PCBP2 protein localization

• CRISPR screening:

  • Using PCBP2 antibodies to validate hits from CRISPR screens

  • Combining genetic perturbation with proteomic analysis

  • Identifying synthetic lethal interactions

Recent studies have used CRISPR-Cas9 to generate PCBP2 knockout cell lines and mice models, which are then validated using PCBP2 antibodies to confirm complete protein loss .

How can PCBP2 antibodies be used in combination with other research tools to gain mechanistic insights?

Integrative approaches combining PCBP2 antibodies with other techniques provide comprehensive insights:

• Transcriptomics integration:

  • Combine PCBP2 RIP-seq with RNA-seq of PCBP2-depleted cells

  • Identify direct versus indirect effects on RNA regulation

  • Correlate PCBP2 binding with RNA stability changes

• Structure-function analysis:

  • Pair antibody-based functional studies with structural biology

  • Use domain-specific antibodies to probe structural features

  • Combine with mutagenesis to map critical residues

• Systematic interaction mapping:

  • Use PCBP2 antibodies for immunoprecipitation followed by mass spectrometry

  • Compare interactomes under different cellular conditions

  • Validate key interactions with orthogonal methods

• In vivo models:

  • Use tissue-specific PCBP2 knockout mice combined with antibody staining

  • Track phenotypic changes alongside molecular alterations

  • Apply PCBP2 antibodies for histological analysis of affected tissues

Research has demonstrated that combining PCBP2 immunoprecipitation with mass spectrometry identified cGAS as an interaction partner, which was then validated using domain mapping and functional studies to reveal PCBP2's role in antiviral immunity .

What is the significance of PCBP2 in RNA phase separation, and how can antibodies help study this phenomenon?

Recent discoveries highlight PCBP2's role in biomolecular condensates:

• Phase separation biology:

  • PCBP2 attenuates cGAS aggregates and cGAS-DNA phase separation

  • This impacts innate immune signaling efficiency

  • PCBP2 may play similar roles with other RNA-protein complexes

• Methodological approaches:

  • Use PCBP2 antibodies to track protein localization to phase-separated compartments

  • Immunofluorescence to visualize co-localization with stress granules or P-bodies

  • Combine with live-cell imaging of tagged components

• Functional consequences:

  • Phase separation may concentrate RNA-binding proteins with their targets

  • This can enhance or inhibit enzymatic activities

  • PCBP2 antibodies help correlate localization with function

• Technical considerations:

  • Fixation methods can affect visualization of biomolecular condensates

  • Consider using low concentrations of paraformaldehyde

  • Combine antibody staining with fluorescent RNA probes

Research has shown that PCBP2 evidently attenuates cGAS aggregates and cGAS-DNA phase separation, suggesting a novel mechanism by which PCBP2 regulates innate immune responses .

How can researchers quantitatively analyze PCBP2 expression levels across different experimental conditions?

Quantitative approaches using PCBP2 antibodies include:

• Western blot quantification:

  • Use appropriate loading controls (GAPDH, β-actin)

  • Include calibration standards for absolute quantification

  • Analyze using densitometry software with linear dynamic range

• Flow cytometry applications:

  • For intracellular PCBP2 detection in heterogeneous populations

  • Combine with surface markers for cell-type specific analysis

  • Use mean fluorescence intensity for relative quantification

• ELISA-based quantification:

  • Sandwich ELISA with recombinant standards

  • Detection limit of approximately 0.1 ng/ml reported for some formats

  • Suitable for high-throughput screening applications

• Image-based quantification:

  • Measure immunofluorescence intensity across subcellular compartments

  • Use automated image analysis for unbiased quantification

  • Compare nuclear/cytoplasmic ratios under different conditions

Researchers studying PCBP2 in pancreatic β cells have successfully used quantitative immunofluorescence to demonstrate ~80% depletion of PCBP2 in conditional knockout models, providing a template for similar quantitative approaches .