PES1 Antibody, HRP conjugated

What is PES1 and what is its biological significance?

PES1 (Pescadillo Ribosomal Biogenesis Factor 1) is a nucleolar protein that plays critical roles in embryonic development and ribosome biogenesis. The protein has a molecular weight of approximately 69 kDa and is encoded by the PES1 gene (GeneID: 23481, UniProt ID: O00541) .

Importantly, PES1 is significantly overexpressed in cancer tissues. Research has shown that 33.6% (89/265) of colon cancer tissues exhibit positive PES1 expression, compared to only 2.7% (7/265) of adjacent normal tissues (P<0.001) . Furthermore, 50% (20/40) of lymph nodes from cancer patients showed positive PES1 staining . This differential expression pattern highlights PES1's potential role as a cancer biomarker.

Functional studies have demonstrated that PES1 promotes colon cancer cell proliferation and growth both in vitro and in vivo. Silencing PES1 via shRNA results in G1/S phase arrest, with flow cytometry analysis showing an accumulation of cells in G1 phase and reduction in S phase upon PES1 ablation .

Why are HRP-conjugated antibodies advantageous for immunodetection assays?

Horseradish peroxidase (HRP) is ideal for antibody conjugation for several reasons:

• Physical characteristics: HRP is a relatively small glycoprotein (44 kDa) with 4 lysine residues available for conjugation, making it technically suitable for antibody attachment .

• Performance advantages: HRP offers greater stability, lower cost, and higher turnover rate compared to alternative enzyme conjugates, allowing the generation of strong signals in a relatively short timespan .

• Signal amplification: Using HRP conjugated antibodies amplifies the signal and increases sensitivity considerably, making it easier to detect proteins of interest in complex mixtures .

• Versatility: HRP catalyzes reactions that generate various detectable outputs (colored, fluorimetric, or luminescent), providing flexibility in detection methods .

• Compatibility: HRP-conjugated antibodies are compatible with multiple applications including Western blotting, ELISA, flow cytometry, and immunohistochemistry .

It's worth noting that HRP activity can be inhibited by cyanides, azides, and sulfides, which should be avoided in experimental buffers when using these conjugates .

What are the specific characteristics of commercially available PES1 Antibody, HRP conjugated?

Commercial PES1 Antibody, HRP conjugated products typically have the following specifications:

This information is compiled from multiple commercial sources and represents typical specifications for these research reagents.

How should researchers optimize antibody validation to ensure specificity for PES1 detection?

Rigorous validation of PES1 antibodies is essential before application in research contexts. Based on documented validation approaches:

• Multiple detection methods: Validate antibody specificity using complementary techniques such as ELISA, Western blot, and immunocytochemistry. In previous studies, monoclonal antibodies against PES1 were validated by showing they specifically bound to GST-PES1 protein but not to GST alone in both ELISA and Western blot analyses .

• Knockdown/knockout validation: A definitive validation approach involves analyzing cell lysates from control and PES1-depleted cells. For example, a commercial antibody (mAb 3B1) was confirmed to specifically detect PES1 when the expected 69 kD band was ablated in cells transfected with PES1 shRNA .

• Comparison with commercial antibodies: When developing new antibodies, comparing their performance with established commercial antibodies can provide validation confirmation. Research demonstrated that a newly developed mAb 3B1 could be utilized in ELISA, Western blot and immunocytochemistry with higher sensitivity and affinity compared to a previously available commercial antibody .

• Cross-reactivity testing: Test for cross-reactivity with closely related proteins or in non-target species to confirm specificity.

• Positive controls: Include known positive tissue or cell samples where PES1 expression has been well-characterized (e.g., colon cancer tissues where PES1 is known to be overexpressed) .

These validation steps should be adapted for HRP-conjugated antibodies with appropriate consideration for the potential impact of conjugation on binding affinity.

What approach should be used when multiplexing experiments with HRP-conjugated antibodies?

When designing multiplex experiments that include HRP-conjugated antibodies, researchers should follow these methodological guidelines:

• Validation of multiplexing: Always validate multiplexed detection by comparing with single-plex detection of each target to ensure no cross-reactivity or signal interference occurs.

What bioconjugation principles underlie the creation of HRP-conjugated antibodies?

The bioconjugation of antibodies to HRP involves specific chemical processes designed to maintain antibody functionality while adding enzymatic reporting capability:

• Cross-linker chemistry: Heterobifunctional cross-linkers are the preferred method for conjugating antibodies to HRP. For example, Sulfo-SMCC (sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate) is commonly used to generate a stable maleimide-activated HRP that can react with sulfhydryl groups .

• Antibody preparation: Sulfhydryl groups are generally introduced into antibodies through SATA-mediated thiolation (SATA: N-succinimidyl S-acetylthioacetate). This controlled chemical modification creates reactive sites on the antibody without compromising its antigen binding regions .

• Conjugation ratio optimization: The ratio of HRP to antibody must be optimized to ensure sufficient enzyme activity while preserving antibody binding capacity. Too high a ratio can hinder antibody-antigen interaction, while too low a ratio results in inadequate signal generation.

• Purification: Following conjugation, the antibody-HRP complex typically undergoes purification steps to remove unreacted components and optimize performance in downstream applications.

• Stabilization: Buffer components like glycerol (50%) and preservatives (e.g., 0.03% Proclin 300) are added to maintain both antibody integrity and enzymatic activity of the conjugate during storage .

This bioconjugation process aims to create a reagent that maintains the specificity of the original antibody while gaining the signal-generating capability of HRP.

How can PES1 detection be applied to study its role in cancer progression?

PES1 has emerged as a significant factor in cancer progression, particularly in colon cancer, with several approaches for investigating its role:

• Expression profiling: Immunohistochemical analysis using PES1 antibodies has revealed strong nuclear staining in cancer cells and lymph nodes. Quantitative data shows 33.6% positivity in colon cancer tissues versus only 2.7% in adjacent normal tissues, with 50% positivity in lymph nodes . This differential expression pattern establishes PES1 as a potential cancer biomarker.

• Functional characterization using knockdown models: Lentiviral-mediated stable ablation of PES1 in colon cancer cell lines (HCT116, RKO, and SW480) significantly inhibited:

  • Cell proliferation (measured by growth curves)

  • Colony formation capacity

  • Xenograft tumor growth in vivo

• Cell cycle analysis: Flow cytometry of PES1-depleted cells showed G1/S arrest, with increased cell accumulation in G1 phase and decreased S phase populations .

• Transcriptional regulation studies: Chromatin immunoprecipitation (ChIP) assays revealed that c-Jun directly binds to the PES1 promoter region. The specific binding site was mapped to the -274/-264 region using deletion mutants in luciferase reporter assays .

• Signal pathway analysis: The JNK signaling pathway was identified as a key regulator of PES1 expression. Treatment with SP600125 (JNK inhibitor) decreased PES1 promoter activity and protein expression in a concentration-dependent manner .

• Downstream target identification: Microarray analysis of PES1-silenced cells identified 633 differentially expressed genes (305 up-regulated, 328 down-regulated). Specific genes confirmed to be affected include bcl2, fgf9, satb1, avp (down-regulated) and id3, msx2, gdf11, and smad3 (up-regulated) .

HRP-conjugated PES1 antibodies can facilitate many of these investigation approaches, particularly in protein expression analysis via immunoblotting or ELISA.

What strategies can overcome signal strength limitations when using HRP-conjugated primary antibodies?

When working with HRP-conjugated primary antibodies like PES1 Antibody, HRP conjugated, several strategies can address signal strength limitations:

• Signal enhancement systems: Enhanced chemiluminescence (ECL) substrates of varying sensitivity can be selected based on the expected abundance of the target protein. For low-abundance targets, super-sensitive ECL substrates may be required.

• Substrate exposure optimization: For chemiluminescence detection, optimize exposure times based on empirical testing. Signal from HRP-conjugated primary antibodies is typically weaker than indirect detection methods, often requiring longer exposure times .

• Sample loading adjustment: For Western blotting applications, increasing protein loading can compensate for lower detection sensitivity, provided that the target protein's abundance doesn't exceed the linear range of detection.

• Buffer optimization: Ensure that experimental buffers do not contain HRP inhibitors such as cyanides, azides, or sulfides, which can significantly reduce signal strength .

• Antibody concentration optimization: Titrate the HRP-conjugated antibody concentration to identify the optimal dilution that provides sufficient signal while minimizing background. As noted in product specifications, for research applications, optimal dilutions/concentrations should be determined by the end user .

• Signal amplification systems: Consider enzymatic signal amplification systems compatible with HRP, such as tyramide signal amplification, which can significantly enhance detection sensitivity.

• Alternative approach for critical applications: For particularly challenging targets or applications requiring maximum sensitivity, consider the indirect detection approach with unconjugated primary antibody and HRP-conjugated secondary antibody, which typically provides 30X stronger signal .

How can researchers interpret ChIP data related to transcriptional regulation of PES1?

Chromatin immunoprecipitation (ChIP) data has revealed important insights into PES1 transcriptional regulation, particularly by c-Jun. When interpreting such data:

• Binding site identification: ChIP assays using anti-c-Jun antibody followed by PCR with specific primers demonstrated that c-Jun directly interacts with the PES1 promoter region in multiple colon cancer cell lines (HCT116, RKO, SW480). The specific binding region was mapped to coordinates -274/-264 of the PES1 promoter .

• Experimental validation: The c-Jun binding site was confirmed through multiple complementary approaches:

  • Luciferase reporter assays with deletion mutants showed deletion from -274 to -264 caused ~80% reduction in reporter activity

  • ChIP assays confirmed in vivo binding

  • Electrophoretic mobility shift assay (EMSA) provided in vitro confirmation

• Specific primer selection: For ChIP-PCR validation, researchers used:

  • Specific primers for c-Jun binding (Primer-S, 139 bp fragment, −363 to −225 region of PES1 promoter):
    Forward primer: CTTGACAACGCAATCCTATCG
    Reverse primer: CCTGATGACGATTCATTGACTGT

  • Negative control primers (Primer-N, 110 bp fragment, −1473 to −1364 region):
    Forward primer: CAACTAGCTGGGGTTACAGG
    Reverse primer: GAGATCAGGAGTTTGAGAC

• Pathway integration: JNK signaling was identified as the primary upstream pathway regulating c-Jun-mediated activation of PES1. Treatment with SP600125 (JNK inhibitor) decreased phosphorylation of c-Jun and correspondingly reduced PES1 expression in a concentration-dependent manner .

• Functional confirmation: JNK1 knockdown using siRNA decreased both PES1 promoter activity and mRNA/protein expression, providing further evidence of this regulatory pathway .

These findings provide a framework for understanding the transcriptional control of PES1, which could be valuable for developing therapeutic strategies targeting its expression in cancer.

What are the critical considerations for Western blot experiments using HRP-conjugated antibodies?

For optimal Western blot results using HRP-conjugated antibodies like PES1 Antibody, HRP conjugated:

• Protein denaturation conditions: When preparing samples, use appropriate denaturants and reducing agents to ensure epitope accessibility. Standard SDS-PAGE conditions (95°C for 5 minutes in buffer containing SDS and β-mercaptoethanol) are typically suitable.

• Transfer optimization: For PES1 (69 kDa), standard semi-dry or wet transfer protocols are appropriate. Complete transfer can be verified using reversible staining methods like Ponceau S.

• Blocking optimization: Use blocking buffers that effectively reduce background without interfering with antibody-antigen interaction. Typically, 5% non-fat milk or BSA in TBST is effective for most HRP-conjugated antibodies.

• Antibody dilution: HRP-conjugated primary antibodies generally require careful titration. For PES1 Antibody, HRP conjugated, following manufacturer recommendations for dilution ranges (typically 0.04-0.4 μg/mL for immunoblotting applications) is a good starting point .

• Direct vs. indirect detection comparison: Be aware that direct detection using HRP-conjugated primary antibodies typically produces significantly weaker signals (~30X less) than indirect detection methods using unconjugated primary followed by HRP-conjugated secondary antibodies .

• Controls: Include appropriate controls:

  • Positive control: Cell lines known to express PES1, such as HCT116 colon cancer cells

  • Negative control: Consider using PES1-knockdown cells if available

  • Loading control: Use established loading controls like GAPDH or β-actin

• Signal development optimization: Choose a chemiluminescent substrate appropriate for the expected expression level of PES1. Exposure times should be empirically determined to ensure optimal signal-to-noise ratio.

• Multiplexing considerations: If detecting multiple proteins simultaneously, refer to the multiplexing guidelines discussed in section 2.2, paying particular attention to signal balancing strategies.

How can PES1 knockdown studies illuminate downstream pathways regulated by this protein?

PES1 knockdown studies have provided valuable insights into its downstream regulatory networks, particularly in cancer:

• Experimental approach: Lentiviral-mediated stable ablation of PES1 in colon cancer cell lines (HCT116, RKO, SW480) using multiple shRNA constructs ensures robust and specific knockdown. Verification of knockdown efficiency was performed at both protein and mRNA levels .

• Phenotypic consequences: PES1 depletion resulted in:

  • Significant inhibition of cell proliferation

  • Reduced colony formation capacity

  • G1/S cell cycle arrest (increased G1 population, decreased S phase)

  • Inhibition of tumor growth in xenograft models

• Transcriptome analysis: Microarray analysis comparing PES1-silenced and control HCT116 cells identified 633 differentially expressed genes (305 up-regulated, 328 down-regulated). Bioinformatic analysis using Gene Ontology tools revealed pathways affected by PES1 ablation, with genes related to cell proliferation constituting the primary category .

• Validation of specific targets: Quantitative RT-PCR confirmed down-regulation of pro-survival/proliferation genes (bcl2, fgf9, satb1, avp) and up-regulation of differentiation/growth arrest genes (id3, msx2, gdf11, smad3) upon PES1 silencing in multiple cell lines .

• Pathway integration: Combined with data on PES1 regulation by c-Jun/JNK signaling, these findings suggest PES1 functions as a central node connecting upstream mitogenic signals to downstream effectors controlling proliferation, survival, and differentiation in cancer cells.

• Experimental validation methods: When using HRP-conjugated antibodies to study these pathways, researchers can employ Western blotting to detect changes in protein levels or activation states of downstream targets following PES1 manipulation.

These approaches collectively establish PES1 as a crucial factor in cancer cell proliferation and identify potential therapeutic targets in the PES1-regulated network.