PFDN5 Antibody

What is PFDN5 and why is it significant in research?

PFDN5 (Prefoldin Subunit 5) is one of six subunits of the prefoldin complex, a molecular chaperone that binds and stabilizes newly synthesized polypeptides, facilitating proper protein folding. It is particularly important for the folding of tubulin and actin . PFDN5 is ubiquitously expressed and plays critical roles in:

• Central nervous system development and function

• Photoreceptor maintenance

• Male fertility and reproduction

• Transcriptional regulation

• Pre-mRNA splicing processes

Research significance stems from genetic disruption studies showing that PFDN5 mutations lead to reduced function of microtubules and microfilaments, resulting in photoreceptor degeneration, CNS abnormalities, and male infertility . These diverse phenotypes highlight PFDN5's fundamental cellular functions.

What are the standard applications for PFDN5 antibodies in scientific research?

PFDN5 antibodies have been validated for multiple applications based on research needs:

For optimal results, application-specific validation is recommended as reactivity can vary between human, mouse, and rat PFDN5 .

How should researchers validate PFDN5 antibodies before experimental use?

Proper validation of PFDN5 antibodies should include:

• Positive controls: Use tissues or cell lines known to express PFDN5 (broadly expressed but particularly in neuronal tissues)

• Negative controls: Utilize PFDN5 knockout/knockdown samples as demonstrated in multiple studies

• Specificity testing: Consider using CRISPR-Cas9 generated PFDN5 null cell lines as negative controls

• Cross-reactivity assessment: If using in multiple species, verify reactivity in each species independently

• Application-specific validation: An antibody that works well for WB may not perform optimally for ChIP or IHC

• Lot-to-lot consistency: Check performance when switching to a new lot

Research has shown that PFDN5 null mutant clones can be effectively generated and selected by the absence of PFDN5 protein in western blot , providing excellent negative controls.

How can PFDN5 antibodies be effectively utilized in studying pre-mRNA splicing?

PFDN5 has been demonstrated to play a significant role in co-transcriptional pre-mRNA splicing . When implementing studies in this area:

• ChIP followed by RNA analysis: Use PFDN5 antibodies for ChIP to isolate PFDN5-associated chromatin regions, then analyze associated RNA to identify splicing patterns

• Exon ratio analysis: Compare exon:intron ratios between wild-type and PFDN5-depleted cells using RT-qPCR after immunoprecipitation

• Combined approaches: Integrate ChIP-seq data with transcriptomic analysis to correlate PFDN5 binding with splicing events

Research has shown that PFDN5 depletion affects alternative pre-mRNA processing in approximately 20% of genes studied, with no particular class of splicing event being particularly enhanced or suppressed . For experimental design, researchers should:

• Establish PFDN5 knockdown or knockout models (siRNA or CRISPR-Cas9)

• Perform RNA-seq analysis before and after manipulation

• Use bioinformatic tools like SUPPA to analyze alternative processing events

• Validate findings using RT-qPCR on specific introns of target genes

What methodological considerations are important when using PFDN5 antibodies in ChIP-seq experiments?

ChIP-seq with PFDN5 antibodies requires specific technical considerations:

• Fixation optimization: Research shows reduced fixation (6 minutes) and sonication steps are beneficial for PFDN5 ChIP-seq

• RNase treatment controls: Include RNase-treated samples to determine whether PFDN5 binding to chromatin is RNA-mediated

• Appropriate controls: Use Flag-only or IgG controls when using Flag-tagged PFDN5 constructs

• Correlation analysis: Compare PFDN5 ChIP-seq signals with RNA Pol II occupancy data to establish functional relationships

• Signal quantification: Quantify PFDN5 signal on gene bodies or promoters (TSS ± 500 bp) and correlate with expression data

Studies have demonstrated that PFDN5 binding to chromatin is not mediated by nascent pre-mRNA, as RNase treatment before immunoprecipitation still shows significant ChIP signals . This finding suggests direct chromatin association of PFDN5, an important consideration for experimental design.

How can researchers use PFDN5 antibodies as diagnostic or prognostic biomarkers in clinical research?

PFDN5 antibodies have shown potential as biomarkers in several clinical contexts:

For ankylosing spondylitis (AS) with uveitis:

• Anti-PFDN5 antibody levels in sera from AS patients with uveitis are significantly higher than in AS without uveitis

• PFDN5 protein levels in serum are also elevated in AS with uveitis

• Consider using ELISA with cutoff values determined through ROC curve analysis

For CNS leukemia prediction:

• PFDN5-α-CSF reactivity can be assessed by ELISA to predict CNS leukemia risk

• A cutoff value of 0.456 has been established, with values below this threshold indicating risk for developing CNS leukemia

• Validation through flow cytometry shows decreasing PFDN5-α-CSF reactivity with increasing blast cells

For cancer prognosis:

Methodological approach should include:

• Establishing appropriate cohorts with matched controls

• Using standardized ELISA protocols with validated antibodies

• Performing ROC analysis to determine clinically relevant cutoff values

• Validating findings through alternative methods (Western blot, flow cytometry)

What are the technical challenges in distinguishing between PFDN5 isoforms using antibody-based methods?

Distinguishing between PFDN5 isoforms presents several technical challenges:

• Epitope selection: Different commercial antibodies target various regions of PFDN5 (e.g., AA 2-154, AA 79-108, AA 40-139)

• Isoform specificity: Some antibodies may recognize multiple isoforms depending on the epitope region

• Validation approaches: Western blotting with recombinant isoforms is essential to confirm specificity

For researchers needing isoform-specific detection:

• Select antibodies targeting unique regions of specific isoforms

• Validate using overexpression systems with tagged isoforms

• Consider using a panel of antibodies targeting different epitopes

• Combine with mass spectrometry for definitive isoform identification

PFDN5-α has been specifically identified as a prognostic biomarker for predicting CNS leukemia through interactome studies , demonstrating the importance of isoform-specific detection in clinical research applications.

How can researchers optimize PFDN5 knockdown experiments to study its function?

Based on published methodologies, researchers can optimize PFDN5 knockdown experiments by:

• siRNA selection: The sequence siPFDN5 (AGAGAAGACAGCUGAGGAU) has been effectively used to deplete PFDN5 in human cells

• Knockdown efficiency assessment: Western blotting shows 55% reduction of PFDN5 protein after 72 hours of siRNA treatment

• Experimental timing: Consider cell type-specific dynamics; in HCT116 cells, 24h transfection followed by 48h serum starvation provides optimal conditions

• Alternative approaches: CRISPR-Cas9 can generate complete PFDN5 null cell lines using the gRNA sequence: TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGTACAGACCAAGTATG

• Phenotypic assessment: Monitor effects on tubulin/actin cytoskeleton, pre-mRNA splicing, and cell viability

For analyzing knockdown effects on gene expression:

• Design experiments that include regulated gene expression conditions (e.g., serum stimulation after starvation)

• Collect samples at multiple timepoints to capture dynamic effects

• Use RNA-seq to identify global transcriptomic changes

• Validate key findings using RT-qPCR for specific genes

What is the relationship between PFDN5 and disease pathogenesis, and how can antibodies help elucidate these mechanisms?

PFDN5 has been implicated in multiple disease mechanisms:

In uveitis:

• Higher anti-PFDN5 antibody levels correlate with uveitis development in ankylosing spondylitis

• PFDN5 appears to protect retinal cells against apoptosis

• Knockdown of PFDN5 in ARPE19 cells increases apoptosis, suggesting a protective role

In neurological disorders:

• PFDN5 is required for normal sensory and neuronal development

• Genetic disruption in murine Pfdn5 causes photoreceptor degeneration and CNS abnormalities

• Research suggests these phenotypes result from reduced microtubule and microfilament formation

In cancer:

Research methodologies using antibodies:

• Use anti-PFDN5 antibodies to track protein expression in disease models

• Employ immunohistochemistry to analyze tissue-specific expression patterns

• Perform co-immunoprecipitation to identify disease-specific interaction partners

• Monitor PFDN5 expression in response to therapeutic interventions

How does PFDN5 interact with other prefoldin complex components, and what methodologies can elucidate these interactions?

PFDN5 functions as part of the heterohexameric prefoldin complex consisting of two alpha subunits (including PFDN5) and four beta subunits. To study these interactions:

• Co-immunoprecipitation: Use PFDN5 antibodies to pull down the entire prefoldin complex, followed by identification of associated proteins

• Proximity ligation assay: Detect in situ protein-protein interactions between PFDN5 and other prefoldin subunits

• Yeast two-hybrid screening: Identify direct interacting partners using PFDN5 as bait

• Structural studies: Combine with crystallography or cryo-EM to determine binding interfaces

The prefoldin complex forms a double beta barrel assembly with six protruding coiled-coils , and understanding PFDN5's position and interactions within this complex is crucial for comprehending its function.

Research approaches might include:

• Generating truncated PFDN5 constructs to map interaction domains

• Performing site-directed mutagenesis to identify critical residues

• Using FRET or BRET to monitor interactions in living cells

• Employing mass spectrometry to identify post-translational modifications affecting interactions

Each prefoldin subunit appears to confer distinct substrate specificity to the prefoldin holocomplex , making the study of PFDN5-specific interactions particularly valuable for understanding its unique functions.