PFDN5 Human

What is PFDN5 and what is its fundamental role in human cells?

Human prefoldin subunits, including PFDN5, have been implicated in several nuclear functions, with PFDN5 specifically shown to be involved in gene expression regulation. The canonical prefoldin complex containing PFDN5 appears to support efficient co-transcriptional splicing, particularly under conditions of regulated gene expression such as during serum stimulation following starvation .

How does PFDN5 function independently versus as part of the prefoldin complex?

While prefoldin operates as a stable heterohexameric complex, evidence suggests that individual subunits like PFDN5 can function independently. Specifically, human PFDN5 can inhibit the transactivation domain of Myc by recruiting histone deacetylases and promoting Myc degradation. This interaction between Myc and PFDN5 is subunit-specific and does not involve other prefoldin components .

What experimental systems are suitable for PFDN5 depletion studies?

Human cell lines, particularly HCT116 colon carcinoma cells, have been successfully used for PFDN5 depletion studies. Both transient depletion (siRNA) and permanent knockout (CRISPR-Cas9) approaches have proven effective. For siRNA-mediated depletion, researchers have achieved approximately 55% reduction in PFDN5 protein levels using the sequence AGAGAAGACAGCUGAGGAU at 20 nM concentration, transfected using Oligofectamine .

For CRISPR-Cas9 gene knockout, researchers have successfully generated PFDN5-null cell lines using the gRNA sequence TTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCGGTACAGACCAAGTATG. Selection of knockout clones can be accomplished through western blot screening for absence of PFDN5 protein, followed by PCR amplification and sequencing of the target region to confirm mutations .

What methodologies are most effective for studying PFDN5's chromatin association?

Chromatin immunoprecipitation (ChIP) followed by sequencing (ChIP-seq) has proven effective for mapping PFDN5 genomic binding sites. Researchers have successfully implemented the following protocol:

• Crosslink cells with 1% formaldehyde for 10 minutes

• Sonicate chromatin to fragments of approximately 200-300 bp

• Immunoprecipitate with anti-Flag or anti-PFDN5 antibodies

• Perform standard ChIP procedures including reversal of crosslinks and DNA purification

• Quantify by qPCR or prepare libraries for sequencing

To determine whether RNA mediates PFDN5-chromatin interactions, researchers have modified this protocol by:

• Reducing fixation and sonication to 6 minutes

• Treating sonicated chromatin with RNase cocktail (300U RNase T1 + 45U RNase A) for 2 hours at 30°C before immunoprecipitation

ChIP-seq analysis has revealed that PFDN5 associates with actively transcribed genes, with enrichment patterns correlating with RNA polymerase II occupancy, suggesting co-transcriptional activity .

How can researchers effectively analyze PFDN5's impact on transcription and pre-mRNA processing?

RNA-seq analysis of control versus PFDN5-depleted cells provides comprehensive insights into transcriptional impacts. For studying regulated gene expression, a serum starvation/stimulation experimental design has proven valuable:

• Transfect cells with siRNA for 24 hours

• Serum-starve cells for 48 hours

• Stimulate with serum and collect samples before and after stimulation (e.g., at 90 minutes)

• Perform RNA-seq analysis

For analyzing pre-mRNA splicing efficiency:

• Calculate exon/intron ratios from RNA-seq data

• Compare these ratios between control and PFDN5-depleted cells

• Validate key findings using RT-qPCR with primers designed to amplify specific introns

Alternative splicing events can be analyzed using computational tools like SUPPA, which identified approximately 20% of genes with alternative processing events affected by PFDN5 depletion .

What is the relationship between PFDN5 chromatin binding and gene expression regulation?

ChIP-seq analysis of PFDN5 has revealed a negative correlation between PFDN5 chromatin occupancy and the impact of PFDN5 depletion on gene expression. Specifically, genes with higher PFDN5 binding show greater dependence on PFDN5 for their expression. This relationship suggests a direct functional role of chromatin-bound PFDN5 in gene expression regulation .

Interestingly, the correlation between PFDN5 ChIP-seq signals and gene expression levels in non-depleted cells is relatively weak, indicating that PFDN5 is not simply binding to highly expressed genes but rather plays a regulatory role that becomes apparent upon its depletion .

The data reveals PFDN5 contributions to gene regulation are particularly evident under dynamic conditions such as serum stimulation, suggesting its importance for regulated rather than basal transcription .

How does PFDN5 contribute to co-transcriptional pre-mRNA splicing?

This effect is particularly pronounced in highly expressed genes, suggesting that PFDN5 becomes more critical for splicing efficiency when transcriptional activity is high. Validation experiments in PFDN5 knockout cells confirmed higher levels of unspliced pre-mRNA for selected genes (SRRM2 and FASN) following serum stimulation .

The coupling of transcription and splicing is not essential for splicing to occur, which explains why PFDN5's contribution to splicing becomes apparent primarily under serum stimulation conditions that trigger increased transcriptional activity .

What impact does PFDN5 have on alternative pre-mRNA processing events?

Analysis of PFDN5-depleted cells revealed that approximately 20% of genes showed alterations in alternative pre-mRNA processing events. These changes included both suppressed events (occurring at least 10% less frequently in PFDN5-depleted than in control cells) and enhanced events (occurring at least 10% more frequently in PFDN5-depleted than in control cells) .

Interestingly, no specific class of alternative processing event was particularly enhanced or suppressed by PFDN5 depletion, suggesting a broad rather than selective impact on the splicing machinery. This finding indicates that PFDN5 may be supporting general splicing efficiency rather than regulating specific types of alternative processing .

What is known about PFDN5's role in cancer progression?

Human prefoldin, including PFDN5, has been implicated in epithelial-mesenchymal transition (EMT), a process crucial for cancer metastasis. While PFDN1 has been more extensively studied in this context, with described roles in mediating EMT in lung cancer cell lines and metastasis in mouse models, PFDN5 is part of the prefoldin complex that has been linked to increased risk of mortality and metastasis in non-small cell lung cancer .

The current model suggests that prefoldin overexpression alters the expression pattern of EMT regulatory genes. The findings regarding PFDN5's role in gene expression regulation, particularly in the context of transcription and splicing, may provide mechanistic insights into how prefoldin components like PFDN5 contribute to cancer progression through effects on gene expression programs .

How can researchers design effective experimental approaches to study PFDN5 in disease models?

For studying PFDN5 in disease contexts, researchers should consider:

• Gene expression analysis: RNA-seq of control versus PFDN5-depleted or overexpressing cells, with particular attention to EMT-associated genes and pathways

• Functional assays: Migration, invasion, and adhesion assays to assess the impact of PFDN5 modulation on cancer-relevant phenotypes

• In vivo models: Xenograft studies with PFDN5-modulated cells to assess effects on tumor growth and metastasis

• Patient sample analysis: Correlation of PFDN5 expression levels with clinical outcomes and metastasis in cancer patients

What are the key controls and validation steps for PFDN5 depletion studies?

When conducting PFDN5 depletion studies, researchers should implement the following controls and validation steps:

• Protein level verification: Western blot analysis to confirm reduction of PFDN5 protein levels following siRNA treatment or CRISPR-Cas9 editing

• Multiple depletion approaches: Compare results from transient (siRNA) and permanent (CRISPR-Cas9) depletion to rule out off-target or compensatory effects

• Rescue experiments: Re-expression of PFDN5 in knockout cells to confirm specificity of observed phenotypes

• Multiple cell lines: Test effects in different cellular contexts to assess generalizability

• Sequence validation: For CRISPR-Cas9 edited cells, PCR amplification and sequencing of the targeted region to confirm mutations

What considerations are important when interpreting PFDN5 ChIP-seq data?

When analyzing and interpreting PFDN5 ChIP-seq data, researchers should consider:

• Appropriate controls: Use input DNA and negative controls (material incubated without antibody) for normalization

• RNA dependence: Perform RNase treatment before immunoprecipitation to determine whether chromatin association is RNA-mediated

• Correlation with transcriptional activity: Compare PFDN5 binding patterns with RNA polymerase II occupancy and gene expression data

• Biological replicates: Analyze at least two biological replicates to ensure reproducibility

• Bioinformatic analysis: Use appropriate tools for peak calling, visualization (e.g., deeptools for bigwig files and heatmaps), and correlation analysis