PHLDB1 Antibody

What is PHLDB1 and why is it important in cellular research?

PHLDB1 (Pleckstrin homology-like domain family B member 1) is a protein containing a pleckstrin homology domain that binds phosphatidylinositol PI(3,4)P2, PI(3,5)P2, and PI(3,4,5)P3, along with a Forkhead-associated domain and coiled coil regions . It plays a crucial role in insulin signaling by enhancing Akt activation and is involved in glucose transport mechanisms. PHLDB1 translocates from the cytoplasm to the plasma membrane in response to insulin stimulation, making it an important component in metabolic research . The protein is also known as LL5alpha and is involved in cytoskeleton organization, with widespread expression across multiple tissue types . Research on PHLDB1 is valuable for understanding insulin resistance, diabetes, and potential connections to cancer pathways through its interaction with Akt signaling.

How should PHLDB1 antibodies be stored to maintain optimal reactivity?

PHLDB1 antibodies should be stored according to manufacturer specifications, which typically recommend aliquoting and storing at -20°C . Repeated freeze/thaw cycles should be avoided as they can degrade antibody quality and reduce specificity . Most commercial PHLDB1 antibodies are supplied in buffered aqueous glycerol solutions that help maintain stability during storage . For long-term storage, creating small aliquots immediately upon receipt prevents protein degradation from repeated thawing and refreezing. When working with the antibody, it's advisable to keep it on ice and return it to storage promptly to maintain its functional integrity. Always check specific storage instructions for your particular antibody preparation, as some formulations may have unique requirements.

What are the most common applications for PHLDB1 antibodies in research?

The most commonly used applications for PHLDB1 antibodies include Western Blot and ELISA, with immunohistochemistry also frequently employed . In research settings, PHLDB1 antibodies are valuable for studying insulin signaling pathways, particularly for investigating Akt activation and glucose transport through GLUT4 translocation . They are also used in studying cytoskeletal organization and in research related to glioma susceptibility, as PHLDB1 has been implicated in the 11q23.3 glioma susceptibility locus . The antibodies enable detection of endogenous PHLDB1 protein localization before and after insulin stimulation, supporting studies on subcellular translocation from cytoplasm to plasma membrane . For optimal results in these applications, researchers should determine appropriate dilutions through titration experiments, as recommended dilutions can vary by application and antibody source .

How can PHLDB1 antibodies be used to investigate insulin signaling pathways?

PHLDB1 antibodies serve as powerful tools for dissecting insulin signaling pathways through multiple methodological approaches. Researchers can use these antibodies to track the insulin-dependent translocation of PHLDB1 from the cytoplasm to the plasma membrane via immunofluorescence microscopy or subcellular fractionation followed by Western blotting . To establish PHLDB1's role in the insulin signaling cascade, investigators commonly pair PHLDB1 antibody detection with phospho-specific antibodies against Akt/PKB at Thr-308 and Ser-473 sites, which reveals the relationship between PHLDB1 localization and downstream Akt activation . Co-immunoprecipitation experiments using PHLDB1 antibodies can identify binding partners within the signaling complex. For functional studies, researchers can combine PHLDB1 knockdown via siRNA (targeting sequences: GAAGACCCAUGACCGGUUG, AAAGGAAGCUCACGCAGAG, GAAGUCAAGCUCCGGGAAA, and CCUAUUACGUGGACAAACA) with antibody detection of remaining protein to correlate expression levels with phenotypic changes in glucose transport or Akt phosphorylation . These approaches collectively allow researchers to position PHLDB1 precisely within the insulin signaling network and quantify its contribution to metabolic regulation.

What role does PHLDB1 play in the 11q23.3 glioma susceptibility locus?

PHLDB1 has been identified as a key component in the 11q23.3 glioma susceptibility locus through comprehensive functional analysis of genome-wide association studies (GWAS) . The glioma-associated SNP rs498872 is in linkage disequilibrium with several functional SNPs in the promoters of both PHLDB1 and DDX6, suggesting a regulatory relationship . Research using PHLDB1 antibodies in chromatin immunoprecipitation (ChIP) assays can help determine how these polymorphisms affect transcription factor binding and gene expression regulation. Experimental studies revealed that a subset of 10 functional SNPs exist in the promoters of PHLDB1 and DDX6, as well as in a putative enhancer element . A physical interaction between an enhancer element containing the functional SNP rs73001406 and the DDX6 gene promoter was identified through chromatin conformation capture (3C) techniques . Knockdown experiments suggest both PHLDB1 and DDX6 may contribute to the glioma phenotype. Detection of PHLDB1 protein levels using specific antibodies in different glioma subtypes can further elucidate its contribution to tumorigenesis and potentially identify it as a biomarker or therapeutic target for gliomas.

How can PHLDB1 antibodies be used in combination with phosphoinositide binding studies?

PHLDB1 antibodies can be strategically combined with phosphoinositide binding studies to characterize the functional interactions between PHLDB1's pleckstrin homology (PH) domain and specific phosphoinositides. Researchers can purify the PH domain of PHLDB1 using nickel-nitrilotriacetic acid columns and conduct binding assays with liposomes containing various phosphoinositides (PI3P, PI4P, PI5P, PI(3,4)P2, PI(3,5)P2, PI(4,5)P2, and PI(3,4,5)P3) . The binding specificity can be quantified through ultracentrifugation of sucrose-loaded liposomes and subsequent detection of bound protein . PHLDB1 antibodies serve dual purposes in these experiments: first, as detection reagents in Western blot analysis of the binding fractions; and second, in parallel immunolocalization studies to correlate in vitro binding preferences with cellular localization patterns. For advanced studies, researchers can generate point mutations in the PH domain's binding pocket, express these mutants in cell culture, and use PHLDB1 antibodies to assess how these mutations affect both localization and function. This combined approach provides mechanistic insight into how phosphoinositide recognition by PHLDB1 regulates its subcellular targeting and subsequent role in insulin signaling and cytoskeletal organization.

What techniques can be used to study PHLDB1 isoforms and their differential expression?

Multiple approaches can be employed to study the reported three isoforms of PHLDB1 and their differential expression patterns. Western blotting with PHLDB1 antibodies that recognize conserved epitopes can detect all isoforms, revealing their relative abundance across tissue types or experimental conditions . To distinguish between specific isoforms, researchers should design isoform-specific antibodies targeting unique sequence regions or use existing antibodies in combination with molecular weight analysis, as isoforms typically differ in size . RT-qPCR using isoform-specific primers (such as those designed based on primer bank approaches) provides quantitative data on transcript levels . For spatial localization studies, immunohistochemistry or immunofluorescence with PHLDB1 antibodies on tissue sections can reveal tissue-specific expression patterns . For temporal expression analysis during cellular processes like adipocyte differentiation, where PHLDB1 expression increases, time-course studies combining PHLDB1 antibody detection with differentiation markers can be informative . To understand functional differences between isoforms, isoform-specific siRNA knockdown followed by rescue experiments with individual isoforms can reveal their unique contributions to cellular processes such as insulin-stimulated glucose transport or cytoskeleton organization.

What are the optimal fixation and staining protocols for PHLDB1 immunohistochemistry?

For optimal PHLDB1 immunohistochemistry, tissue fixation with 10% neutral buffered formalin for 24-48 hours is recommended to preserve protein structure while allowing antibody accessibility. Paraffin-embedded sections should typically be cut at 4-5 μm thickness . Antigen retrieval is critical, with heat-induced epitope retrieval (HIER) using citrate buffer (pH 6.0) or EDTA buffer (pH 9.0) being most effective for PHLDB1 detection. Commercial PHLDB1 antibodies are recommended to be used at dilutions between 1:20 and 1:50 for immunohistochemistry applications , though optimization through titration is advisable for each new tissue type or fixation method. A blocking step using 5-10% normal serum from the same species as the secondary antibody reduces background staining. For visualization, both DAB (3,3'-diaminobenzidine) chromogenic detection and fluorescent secondary antibodies are compatible with PHLDB1 antibodies. When performing double immunostaining to co-localize PHLDB1 with other proteins, sequential staining protocols with appropriate controls should be employed to prevent cross-reactivity. Counterstaining with hematoxylin provides cellular context while preserving the PHLDB1 signal.

How should RNA interference experiments be designed to validate PHLDB1 antibody specificity?

RNA interference experiments provide crucial validation for PHLDB1 antibody specificity through the following methodological approach. Begin by designing siRNA smart pools targeting PHLDB1, using previously validated sequences such as GAAGACCCAUGACCGGUUG, AAAGGAAGCUCACGCAGAG, GAAGUCAAGCUCCGGGAAA, and CCUAUUACGUGGACAAACA . Include appropriate controls: non-targeting siRNA sequences, positive controls targeting housekeeping genes, and untreated controls. Transfect cells using optimized protocols—for example, 3T3-L1 adipocytes can be transfected by electroporation as described in previous studies . After 48-72 hours to allow protein turnover, prepare cell lysates using SDS lysis buffer (2% SDS, 30 mM NaCl, 10 mM Hepes pH 7.4, 20 mM NaF, 1 mM NaPPi) . Perform Western blotting with your PHLDB1 antibody alongside housekeeping protein controls. A specific antibody will show significant reduction in PHLDB1 signal in siRNA-treated samples compared to controls, while non-specific bands will remain unchanged. Quantify knockdown efficiency using both protein (Western blot) and mRNA (RT-qPCR) levels with primers like mouse PHLDB1 forward (GCAGCCAAGAGTCCGAATCC) and reverse (GGGCCACCATGTAGTACAACC) . This comprehensive approach confirms that bands detected by the antibody genuinely represent PHLDB1 rather than cross-reactive proteins.

What controls are necessary when using PHLDB1 antibodies in phosphorylation-dependent studies?

When using PHLDB1 antibodies in phosphorylation-dependent studies, several critical controls must be implemented. First, include both positive and negative stimulation controls—for PHLDB1, insulin stimulation (e.g., 15 minutes of exposure) serves as a positive control for downstream phosphorylation events, while serum-starved cells provide the negative baseline . Second, incorporate phosphatase inhibitors (such as NaF and NaPPi) in lysis buffers to preserve phosphorylation status . Third, include phospho-specific antibodies against established insulin pathway components (Akt/PKB Thr-308, Akt/PKB Ser-473, p70 S6 kinase Thr-389) alongside PHLDB1 detection to confirm pathway activation . Fourth, perform parallel experiments with pharmacological inhibitors of key kinases (PI3K inhibitors like wortmannin) to establish causality. Fifth, include total protein controls for phospho-proteins to distinguish between changes in phosphorylation versus alterations in protein expression. For advanced studies, compare wild-type cells with those expressing phospho-mimetic or phospho-dead PHLDB1 mutants. Finally, when studying the temporal dynamics of PHLDB1-related phosphorylation events, include multiple time points (0, 5, 15, 30, 60 minutes after stimulation) to capture the complete signaling profile. These controls collectively establish specificity and ensure accurate interpretation of PHLDB1's role in phosphorylation-dependent signaling cascades.

How can researchers optimize Western blotting protocols for PHLDB1 detection?

Optimizing Western blotting for PHLDB1 detection requires careful consideration of several parameters. For cell lysis, use a buffer containing 2% SDS, 30 mM NaCl, 10 mM Hepes (pH 7.4), 20 mM NaF, and 1 mM NaPPi, which effectively solubilizes membrane-associated proteins while preserving phosphorylation status . Given PHLDB1's size (151.2 kDa for the canonical isoform) , use lower percentage (7-8%) polyacrylamide gels or gradient gels (4-15%) to effectively resolve the protein. Extended transfer times (1.5-2 hours) at lower voltage or overnight transfers at 4°C are recommended for complete transfer of large proteins. For blocking, 5% non-fat dry milk in TBS-T works well, though 5% BSA may be preferable when detecting phosphorylated forms. Antibody dilutions should be empirically determined, but studies have successfully used primary antibody incubations at 4°C overnight . Include positive controls (tissues known to express PHLDB1, such as adipose tissue) and molecular weight markers spanning 100-250 kDa. When stripping and reprobing membranes, use gentle stripping buffers to preserve epitopes. For enhanced detection of low-abundance PHLDB1, consider using high-sensitivity chemiluminescent substrates or fluorescent secondary antibodies for quantitative analysis. Finally, quantification should be normalized to appropriate loading controls, considering that traditional housekeeping proteins like GAPDH (37 kDa) run at substantially different molecular weights than PHLDB1.

What are common pitfalls when using PHLDB1 antibodies and how can they be addressed?

Several common pitfalls can arise when working with PHLDB1 antibodies. First, high molecular weight proteins like PHLDB1 (151.2 kDa) may transfer incompletely during Western blotting, creating false negative results. This can be addressed by using longer transfer times, lower percentage gels (7-8%), and specialized transfer conditions for large proteins. Second, antibody specificity issues may manifest as multiple bands or unexpected molecular weights. Researchers should validate antibodies using positive controls (tissues with known PHLDB1 expression), knockdown experiments with siRNA targeting PHLDB1, and comparison with recombinant protein standards . Third, subcellular localization studies may show inconsistent results if insulin stimulation conditions are not optimized. Standardize by using serum starvation (0.5% BSA in DMEM) followed by precisely timed insulin exposure (15 minutes is typical) . Fourth, fixation conditions for immunocytochemistry can mask PHLDB1 epitopes; compare multiple fixation methods (PFA, methanol, acetone) to determine optimal conditions. Fifth, batch-to-batch variability in antibodies can affect reproducibility; document lot numbers and consider purchasing larger lots for long-term projects. Finally, PHLDB1's involvement in dynamic processes like insulin-stimulated translocation requires careful timing of experimental interventions and sample collection to capture relevant biological events .

How can non-specific binding be minimized when using PHLDB1 antibodies?

Non-specific binding can be minimized when using PHLDB1 antibodies through several methodological refinements. First, optimize blocking conditions by testing different blocking agents (5% BSA, 5% non-fat dry milk, commercial blocking buffers) and extending blocking times to 1-2 hours at room temperature . Second, increase the stringency of washing steps by using PBS with 0.1% Tween 20 and performing at least three 15-minute washes after both primary and secondary antibody incubations . Third, titrate antibody concentrations through dilution series experiments to identify the minimal concentration that produces specific signal while minimizing background. Fourth, pre-absorb antibodies with recombinant protein from a closely related family member (such as PHLDB2) to remove cross-reactive antibodies while retaining PHLDB1-specific ones . Fifth, for tissue immunohistochemistry, include an endogenous peroxidase blocking step (3% H2O2 in methanol) and consider using species-specific immunoglobulin blocking reagents. Sixth, reduce secondary antibody cross-reactivity by selecting highly cross-adsorbed secondary antibodies specific to the host species of the primary antibody. Finally, always run parallel negative controls where primary antibody is omitted or replaced with non-immune IgG from the same species and at the same concentration as the PHLDB1 antibody to distinguish between specific signals and background.

How do post-translational modifications affect PHLDB1 antibody recognition?

Post-translational modifications (PTMs) can significantly impact PHLDB1 antibody recognition in experimental settings. PHLDB1 contains multiple potential phosphorylation sites, particularly important given its role in insulin signaling and its interaction with phosphoinositides . Phosphorylation of PHLDB1 may alter epitope accessibility by changing protein conformation or creating steric hindrance, potentially reducing antibody binding efficiency. This is particularly relevant when studying insulin-stimulated cells, where rapid phosphorylation events occur . When selecting antibodies, researchers should determine whether they recognize unmodified PHLDB1 (as specified for some commercial antibodies) or if they detect both modified and unmodified forms. For comprehensive analysis, consider using multiple antibodies targeting different PHLDB1 epitopes. To preserve PTMs during experimental procedures, include appropriate inhibitors in lysis buffers (phosphatase inhibitors: NaF, NaPPi; protease inhibitors: PMSF, protease inhibitor cocktails) . If studying specific PTMs, use specialized antibodies raised against modified peptides or employ mass spectrometry-based approaches for detailed PTM mapping. For validation, compare antibody recognition patterns in samples treated with and without lambda phosphatase to determine phosphorylation-dependent recognition differences.

What are the best approaches for validating PHLDB1 antibody specificity across different species?

Validating PHLDB1 antibody specificity across species requires a systematic approach addressing both sequence homology and experimental validation. First, perform bioinformatic analysis of PHLDB1 protein sequences across target species to identify regions of high conservation that may serve as cross-reactive epitopes. Many commercial PHLDB1 antibodies are developed against human proteins but may cross-react with mouse or rat orthologs due to sequence conservation . Second, conduct Western blot analysis using tissue lysates from multiple species alongside recombinant proteins as positive controls, comparing band patterns and molecular weights to predicted values (human PHLDB1: 151.2 kDa) . Third, perform peptide competition assays using the immunizing peptide to confirm specificity—signal reduction confirms that antibody binding is epitope-specific. Fourth, validate with knockdown/knockout controls in each species being tested; siRNA targeting species-specific PHLDB1 sequences should reduce signal in that species only if the antibody is specific . Fifth, conduct immunoprecipitation followed by mass spectrometry to confirm that the antibody pulls down PHLDB1 from different species. Sixth, if working with evolutionarily distant species, consider using species-specific antibodies rather than assuming cross-reactivity. Finally, document all validation data, including antibody catalog numbers, dilutions, and species-specific results, to facilitate reproducibility and proper experimental design across laboratories studying PHLDB1 in different model organisms.

How might PHLDB1 antibodies contribute to therapeutic target identification in metabolic disorders?

PHLDB1 antibodies can significantly advance therapeutic target identification in metabolic disorders through multiple research applications. Since PHLDB1 enhances Akt activation and is required for optimal insulin-induced glucose transport and GLUT4 translocation , immunohistochemical studies using these antibodies can map PHLDB1 expression patterns in healthy versus diabetic tissues, potentially identifying dysregulation patterns. Researchers can employ PHLDB1 antibodies in high-throughput screening platforms to identify compounds that modulate PHLDB1's subcellular localization or interaction with binding partners, potentially restoring insulin sensitivity. Co-immunoprecipitation studies with PHLDB1 antibodies can isolate protein complexes for mass spectrometry analysis, revealing novel interaction partners that might serve as alternative therapeutic targets. In animal models of insulin resistance or type 2 diabetes, tissue-specific changes in PHLDB1 expression, phosphorylation status, or membrane association can be monitored using these antibodies, correlating molecular changes with disease progression. PHLDB1 antibodies can also facilitate studies on how existing diabetes medications affect PHLDB1 function, potentially revealing previously unrecognized mechanisms of action. By developing phospho-specific PHLDB1 antibodies, researchers could assess the activation state of PHLDB1-dependent pathways, providing biomarkers for therapeutic response monitoring. Collectively, these approaches position PHLDB1 antibodies as valuable tools in translating basic metabolic research into potential clinical applications.

What novel techniques are emerging for studying PHLDB1's role in cytoskeletal organization?

Emerging techniques for studying PHLDB1's role in cytoskeletal organization leverage advanced imaging and molecular approaches. Super-resolution microscopy techniques (STORM, PALM, SIM) combined with PHLDB1 antibody labeling enable visualization of PHLDB1's interaction with cytoskeletal elements at nanometer resolution, revealing previously undetectable spatial relationships . Live-cell imaging using cells expressing fluorescently tagged PHLDB1 constructs, validated against antibody staining patterns, allows real-time tracking of PHLDB1's dynamic association with the cytoskeleton during processes like cell migration or insulin stimulation . Proximity ligation assays using PHLDB1 antibodies paired with antibodies against cytoskeletal proteins can detect and quantify molecular interactions in situ with single-molecule sensitivity. CRISPR-Cas9 genome editing to tag endogenous PHLDB1 with fluorescent proteins or epitope tags enables visualization of physiological expression levels without overexpression artifacts. Optogenetic approaches using light-inducible PHLDB1 recruitment to specific cellular compartments can determine the spatial requirements for PHLDB1's cytoskeletal functions. Mass spectrometry-based interactomics using PHLDB1 antibodies can identify cytoskeleton-associated binding partners under different stimulation conditions. Finally, correlative light and electron microscopy (CLEM) using PHLDB1 antibodies can bridge the resolution gap between fluorescence microscopy and ultrastructural analysis, precisely localizing PHLDB1 within the complex cytoskeletal architecture at electron microscopy resolution.

How can PHLDB1 antibodies be integrated with genomic data to understand disease mechanisms?

Integrating PHLDB1 antibody studies with genomic data offers powerful insights into disease mechanisms through several methodological approaches. Researchers can correlate PHLDB1 protein expression levels detected by immunohistochemistry with gene expression data from the same tissues to identify potential post-transcriptional regulatory mechanisms . For glioma research, PHLDB1 antibodies can be used to assess protein expression in tumor samples stratified by genotype at the 11q23.3 susceptibility locus, connecting genetic risk variants to protein-level consequences . Chromatin immunoprecipitation followed by sequencing (ChIP-seq) using antibodies against transcription factors predicted to bind PHLDB1 regulatory regions can validate the functional effects of SNPs identified in genomic studies . For the ten functional SNPs identified in the PHLDB1 promoter region, researchers can use reporter assays paired with protein expression studies to establish genotype-phenotype correlations . PHLDB1 antibodies can be employed in tissue microarrays to rapidly screen large cohorts of patient samples categorized by genomic profiles, identifying potential biomarkers. Single-cell approaches combining RNA sequencing with antibody-based protein detection can reveal cell-type-specific PHLDB1 regulation patterns that might be obscured in bulk tissue analyses. Finally, animal models with genetic variants corresponding to human risk alleles can be analyzed using PHLDB1 antibodies to trace the developmental and physiological consequences of genomic variation, providing mechanistic insights not possible with genomic data alone.

What is the potential for developing phospho-specific PHLDB1 antibodies in signaling research?

Developing phospho-specific PHLDB1 antibodies represents a significant opportunity for advancing signaling research, particularly given PHLDB1's role in insulin-responsive Akt activation . These specialized antibodies would target specific phosphorylated residues within PHLDB1 that likely regulate its activity, subcellular localization, or protein-protein interactions. The development process would begin with bioinformatic prediction of phosphorylation sites, followed by mass spectrometry validation of sites that are dynamically phosphorylated in response to insulin or other stimuli. Phospho-specific antibodies would be generated using synthetic phosphopeptides as immunogens, with careful antibody validation through phosphatase treatment controls and phospho-mimetic mutants. Once developed, these antibodies would enable temporal mapping of PHLDB1 phosphorylation in relation to its translocation from cytoplasm to plasma membrane following insulin stimulation . They would allow researchers to identify the kinases responsible for PHLDB1 phosphorylation through inhibitor studies and in vitro kinase assays. In disease models such as insulin resistance or cancer, phospho-specific antibodies could reveal aberrant PHLDB1 phosphorylation patterns that contribute to pathology. For high-throughput drug screening, these antibodies could identify compounds that modulate PHLDB1 phosphorylation status. Finally, multiplexed immunofluorescence with multiple phospho-specific antibodies could reveal the sequential phosphorylation events that regulate PHLDB1 function, providing a comprehensive view of its activation dynamics in complex signaling networks.